Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7432
Trapped Gene
Klhl13 (ENSMUSG00000036782)
Vector Insertion
Chr X: 22813148 - 22824486
Public Clones RRS761 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 23% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000318938 (ChrX:22824487..22824683 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTCAGGATACGCTGGAAGC ChrX:22824548..22824567 59.98 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000318938 (ChrX:22824487..22824683 -)
Downstram Exon
ENSMUSE00000318923 (ChrX:22812352..22813147 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTCAGGATACGCTGGAAGC ChrX:22824548..22824567 59.98 55 TGCGCAATTCTTTACTGACG ChrX:22812615..22812634 60.01 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000702439 ChrX:22942082..22942208 AGCTTGGAACAGGGACTTTG ChrX:22942112..22942131 59.33 50
upstream ENSMUSE00000702438 ChrX:22938620..22938710 GCCTTCAGACTGGGACTGAG ChrX:22938684..22938703 59.99 60
upstream ENSMUSE00000624545 ChrX:22892256..22892333 TGCTCAACCCTGAGAAGTGA ChrX:22892305..22892324 59.54 50
upstream ENSMUSE00000702437 ChrX:22892256..22892327 TGCTCAACCCTGAGAAGTGA ChrX:22892305..22892324 59.54 50
upstream ENSMUSE00000702446 ChrX:22862284..22862363 CTGTTGCAGCTCAAAAGAAGAA ChrX:22862316..22862337 59.81 40.91
upstream ENSMUSE00000702444 ChrX:22861686..22861783 ATGGAAAACGAGCTCTCCTG ChrX:22861753..22861772 59.43 50
upstream ENSMUSE00000702442 ChrX:22843811..22843866 No primer for this exon
upstream ENSMUSE00000370594 ChrX:22838561..22838699 GGCAGGAAGTACACGCATCT ChrX:22838596..22838615 60.28 55
upstream ENSMUSE00000702457 ChrX:22838561..22838699 GGCAGGAAGTACACGCATCT ChrX:22838596..22838615 60.28 55
upstream ENSMUSE00000318948 ChrX:22825238..22825370 GGCTTGATGGATTGCTTTGT ChrX:22825335..22825354 60.08 45
upstream ENSMUSE00000318938 ChrX:22824487..22824683 CTTCAGGATACGCTGGAAGC ChrX:22824548..22824567 59.98 55

*** Putative Vector Insertion (Chr X: 22813148 - 22824486) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000318923 ChrX:22812352..22813147 TGCGCAATTCTTTACTGACG ChrX:22812615..22812634 60.01 45
downstream ENSMUSE00000318908 ChrX:22805700..22805813 TGGCAACATAGGTCCATTCA ChrX:22805741..22805760 59.92 45
downstream ENSMUSE00000345795 ChrX:22796397..22797978 TGATGGTGTGGCTTCTTCAG ChrX:22797502..22797521 59.83 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTGGTTAATCGCCTTGCAG ChrX:22818421..22818441 61.29 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCATGGTTATCTGGTCGTG ChrX:22818431..22818451 59.37 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036782