Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7466
Trapped Gene
Kank2 (ENSMUSG00000032194)
Vector Insertion
Chr 9: 21579197 - 21580144
Public Clones RRT060 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 72% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000217592 (Chr9:21580145..21580232 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTCATATCAGCCTGCTTGG Chr9:21580195..21580214 60.76 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000217592 (Chr9:21580145..21580232 -)
Downstram Exon
ENSMUSE00000411828 (Chr9:21578977..21579196 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTCATATCAGCCTGCTTGG Chr9:21580195..21580214 60.76 55 AGCCACTCCTGAAGCACTGT Chr9:21579140..21579159 60.06 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000389762 Chr9:21602926..21602979 No primer for this exon
upstream ENSMUSE00000702625 Chr9:21600524..21600638 GCTGTTGGGGAGACTCAGTT Chr9:21600598..21600617 59.31 55
upstream ENSMUSE00000393980 Chr9:21598901..21600127 GTCTGGAACCCTACGGAACA Chr9:21599073..21599092 59.97 55
upstream ENSMUSE00000217598 Chr9:21585004..21585147 GCCTTCCTCCGTTAATCCAC Chr9:21585127..21585146 60.83 55
upstream ENSMUSE00000217595 Chr9:21584823..21584913 CCCTGAAGTCAACCAGAGGA Chr9:21584851..21584870 60.23 55
upstream ENSMUSE00000217601 Chr9:21584145..21584381 CACGAGAGCACAGAGAACGA Chr9:21584316..21584335 60.33 55
upstream ENSMUSE00000217592 Chr9:21580145..21580232 CCTCATATCAGCCTGCTTGG Chr9:21580195..21580214 60.76 55

*** Putative Vector Insertion (Chr 9: 21579197 - 21580144) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000411828 Chr9:21578977..21579196 AGCCACTCCTGAAGCACTGT Chr9:21579140..21579159 60.06 55
downstream ENSMUSE00000702616 Chr9:21578977..21579196 AGCCACTCCTGAAGCACTGT Chr9:21579140..21579159 60.06 55
downstream ENSMUSE00000376094 Chr9:21577189..21577331 CTCAATGTCGTCCTGGGTCT Chr9:21577218..21577237 60.11 55
downstream ENSMUSE00000702615 Chr9:21577189..21577331 CTCAATGTCGTCCTGGGTCT Chr9:21577218..21577237 60.11 55
downstream ENSMUSE00000337246 Chr9:21574370..21574570 GATCTCCTTGTGTCCGTGCT Chr9:21574399..21574418 60.27 55
downstream ENSMUSE00000702614 Chr9:21574370..21574570 GATCTCCTTGTGTCCGTGCT Chr9:21574399..21574418 60.27 55
downstream ENSMUSE00000356457 Chr9:21574198..21574287 GTTCATGCGTGAGTACAGCA Chr9:21574188..21574207 58.44 50
downstream ENSMUSE00000702613 Chr9:21574198..21574287 GTTCATGCGTGAGTACAGCA Chr9:21574188..21574207 58.44 50
downstream ENSMUSE00000394948 Chr9:21571233..21573448 AGAGACTGGTGGGTGTTTGG Chr9:21571352..21571371 60 55
downstream ENSMUSE00000584853 Chr9:21571233..21573448 AGAGACTGGTGGGTGTTTGG Chr9:21571352..21571371 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACTAATCGCCTTGCAGCAC Chr9:21580076..21580096 60.94 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGACCGTGACTGGGAAAAC Chr9:21580078..21580098 60.41 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032194