Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7470
Trapped Gene
Ccdc94 (ENSMUSG00000003208)
Vector Insertion
Chr 17: 56101587 - 56103552
Public Clones RRM285 (baygenomics) RRG033 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 29% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000139240 (Chr17:56101442..56101586 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000139240 (Chr17:56101442..56101586 +)
Downstram Exon
ENSMUSE00000299607 (Chr17:56103553..56103687 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000694355 Chr17:56098597..56098684 No primer for this exon
upstream ENSMUSE00000541865 Chr17:56100136..56100236 No primer for this exon
upstream ENSMUSE00000139240 Chr17:56101442..56101586 No primer for this exon

*** Putative Vector Insertion (Chr 17: 56101587 - 56103552) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000299607 Chr17:56103553..56103687 No primer for this exon
downstream ENSMUSE00000299572 Chr17:56103909..56104090 No primer for this exon
downstream ENSMUSE00000299533 Chr17:56104592..56104712 No primer for this exon
downstream ENSMUSE00000139249 Chr17:56105931..56106060 No primer for this exon
downstream ENSMUSE00000378280 Chr17:56106951..56107704 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAAGGTAGGGGCTTCATTCA Chr17:56101584..56101604 60.07 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAAGGTAGGGGCTTCATTCA Chr17:56101584..56101604 60.07 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000003208