Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7477
Trapped Gene
Rpl13a (ENSMUSG00000003426)
Vector Insertion
Chr 7: 52382463 - 52382578
Public Clones RRR801 (baygenomics)
Private Clones OST415025 (lexicon) OST223553 (lexicon)
Severity of mutation (?) Insertion after 26% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000203254 (Chr7:52382579..52382644 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000203254 (Chr7:52382579..52382644 -)
Downstram Exon
ENSMUSE00000203242 (Chr7:52382361..52382462 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000662249 Chr7:52384070..52384107 No primer for this exon
upstream ENSMUSE00000662248 Chr7:52382866..52382938 No primer for this exon
upstream ENSMUSE00000203254 Chr7:52382579..52382644 No primer for this exon

*** Putative Vector Insertion (Chr 7: 52382463 - 52382578) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000203242 Chr7:52382361..52382462 No primer for this exon
downstream ENSMUSE00000203251 Chr7:52382079..52382164 No primer for this exon
downstream ENSMUSE00000499860 Chr7:52381848..52381907 No primer for this exon
downstream ENSMUSE00000203246 Chr7:52381485..52381607 No primer for this exon
downstream ENSMUSE00000662247 Chr7:52381293..52381402 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTGTTGCCTTGCTCCTAAT Chr7:52382523..52382543 59.48 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTGTGAAGGCATCAACATT Chr7:52382602..52382622 58.73 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000003426