Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7480
Trapped Gene
2900064A13Rik (ENSMUSG00000055943)
Vector Insertion
Chr 2: 112304975 - 112307137
Public Clones (sanger) RRF058 (baygenomics) RRR812 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 79% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000437071 (Chr2:112304894..112304974 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGCTTCTGCCTAAAGTGGTG Chr2:112304927..112304947 59.93 52.38 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000437071 (Chr2:112304894..112304974 +)
Downstram Exon
ENSMUSE00000338131 (Chr2:112307138..112307591 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGCTTCTGCCTAAAGTGGTG Chr2:112304927..112304947 59.93 52.38 TTGCACGAGATCAACCTCAG Chr2:112307411..112307430 59.98 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000437122 Chr2:112295213..112295457 TTCTCCGTCCTGCTTCTGTT Chr2:112295249..112295268 59.99 50
upstream ENSMUSE00000437093 Chr2:112299617..112299736 ACAGATGGGAGCTTTGTGGT Chr2:112299618..112299637 59.58 50
upstream ENSMUSE00000437081 Chr2:112302958..112303096 GGGCTGGACAGACTTTCTGA Chr2:112303066..112303085 60.39 55
upstream ENSMUSE00000437071 Chr2:112304894..112304974 GTGCTTCTGCCTAAAGTGGTG Chr2:112304927..112304947 59.93 52.38

*** Putative Vector Insertion (Chr 2: 112304975 - 112307137) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000338131 Chr2:112307138..112307591 TTGCACGAGATCAACCTCAG Chr2:112307411..112307430 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGACGGGTAAGCTGACTGC Chr2:112304969..112304989 60.02 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGACGGGTAAGCTGACTGC Chr2:112304969..112304989 60.02 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000055943