Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7499
Trapped Gene
Pcyt1b (ENSMUSG00000035246)
Vector Insertion
Chr X: 90977159 - 90980103
Public Clones RRR606 (baygenomics) RRR055 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 64% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000550255 (ChrX:90977016..90977158 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TATATGCCCGGCGTAATCTC ChrX:90977094..90977113 59.91 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000550255 (ChrX:90977016..90977158 +)
Downstram Exon
ENSMUSE00000301027 (ChrX:90980104..90980292 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TATATGCCCGGCGTAATCTC ChrX:90977094..90977113 59.91 50 TCTTGTCCACCTGGTTCTGG ChrX:90980143..90980162 61.1 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000697499 ChrX:90900202..90900555 TCAGCACTGGGCATATCAAG ChrX:90900361..90900380 59.82 50
upstream ENSMUSE00000379410 ChrX:90920451..90920815 GGGTGGGGGTAACCTCTTTA ChrX:90920539..90920558 60.05 55
upstream ENSMUSE00000301065 ChrX:90947424..90947523 CATGAAAAACTGACCGTTGC ChrX:90947481..90947500 59.17 45
upstream ENSMUSE00000301058 ChrX:90951897..90952013 AAGGGCACTTATGCAAGCAA ChrX:90951958..90951977 60.77 45
upstream ENSMUSE00000301051 ChrX:90963124..90963275 ACTGTGATGAACGAGGCAGA ChrX:90963162..90963181 59.42 50
upstream ENSMUSE00000301043 ChrX:90965518..90965596 TGGCTCACGATGATATTCCA ChrX:90965528..90965547 60.03 45
upstream ENSMUSE00000550255 ChrX:90977016..90977158 TATATGCCCGGCGTAATCTC ChrX:90977094..90977113 59.91 50

*** Putative Vector Insertion (Chr X: 90977159 - 90980103) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000301027 ChrX:90980104..90980292 TCTTGTCCACCTGGTTCTGG ChrX:90980143..90980162 61.1 55
downstream ENSMUSE00000348646 ChrX:90991558..90995287 GTGTGTAGGGCCTGCAAAAT ChrX:90993893..90993912 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACACAGCCAAGGAGCTGAAC ChrX:90977125..90977145 60.45 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACACAGCCAAGGAGCTGAAC ChrX:90977125..90977145 60.45 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035246