Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7512
Trapped Gene
Csnk1a1 (ENSMUSG00000024576)
Vector Insertion
Chr 18: 61729217 - 61735063
Public Clones RRR091 (baygenomics)
Private Clones OST302316 (lexicon) OST35704 (lexicon)
Severity of mutation (?) Insertion after 45% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000143437 (Chr18:61729118..61729216 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TAATGGGTATTGGGCGTCAC Chr18:61729188..61729207 60.58 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000143437 (Chr18:61729118..61729216 +)
Downstram Exon
ENSMUSE00000291907 (Chr18:61735064..61735203 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TAATGGGTATTGGGCGTCAC Chr18:61729188..61729207 60.58 50 GCAGTGCCAGTGAGGTTTTT Chr18:61735164..61735183 60.3 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000625344 Chr18:61714993..61715527 AGCGATCAACATCACCAATG Chr18:61715503..61715522 59.53 45
upstream ENSMUSE00000291977 Chr18:61716157..61716263 GGTTGGCATCCCTCACATAC Chr18:61716243..61716262 60.2 55
upstream ENSMUSE00000143439 Chr18:61727918..61728044 GACCCAGCCTTGAAGACCTC Chr18:61727968..61727987 61.17 60
upstream ENSMUSE00000143437 Chr18:61729118..61729216 TAATGGGTATTGGGCGTCAC Chr18:61729188..61729207 60.58 50

*** Putative Vector Insertion (Chr 18: 61729217 - 61735063) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000291907 Chr18:61735064..61735203 GCAGTGCCAGTGAGGTTTTT Chr18:61735164..61735183 60.3 50
downstream ENSMUSE00000291890 Chr18:61736161..61736239 CCACGGCAGACTGGTTCTAT Chr18:61736230..61736249 60.13 55
downstream ENSMUSE00000372299 Chr18:61736832..61736906 CACCTCAACAGGAGTGGACA Chr18:61736900..61736919 59.71 55
downstream ENSMUSE00000143442 Chr18:61738321..61738427 GCAGCCCACGACAGTAATTT Chr18:61738372..61738391 60.14 50
downstream ENSMUSE00000371770 Chr18:61739993..61740141 CTGGGCTGCTTTCTGCTTTA Chr18:61740059..61740078 60.65 50
downstream ENSMUSE00000702159 Chr18:61739993..61740105 CTGGGCTGCTTTCTGCTTTA Chr18:61740059..61740078 60.65 50
downstream ENSMUSE00000702152 Chr18:61740390..61740394 No primer for this exon
downstream ENSMUSE00000353346 Chr18:61747080..61749035 TTAGGGAAAGCTGGACATGG Chr18:61748244..61748263 60.07 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGTATTGGGCGTCACTGTA Chr18:61729193..61729213 60.78 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCTAAACAACCCGTGACTG Chr18:61732256..61732276 60.55 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024576