Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI752
Trapped Gene
Sfrs1 (ENSMUSG00000018379)
Vector Insertion
Chr 11: 87862718 - 87862913
Public Clones CJ0324 (sanger) PST22364-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 74% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000489619 (Chr11:87862545..87862717 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000489619 (Chr11:87862545..87862717 +)
Downstram Exon
ENSMUSE00000379220 (Chr11:87862914..87865110 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000486255 Chr11:87861173..87861534 No primer for this exon
upstream ENSMUSE00000705979 Chr11:87861187..87861534 No primer for this exon
upstream ENSMUSE00000361135 Chr11:87861992..87862176 No primer for this exon
upstream ENSMUSE00000489619 Chr11:87862545..87862717 No primer for this exon
upstream ENSMUSE00000674824 Chr11:87862545..87867259 No primer for this exon

*** Putative Vector Insertion (Chr 11: 87862718 - 87862913) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000379220 Chr11:87862914..87865110 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGTTTTCTAATCGCCTTGCAG Chr11:87862762..87862783 58.66 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGATACAGTTTTCCGTGACTG Chr11:87862755..87862777 60.03 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018379