Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7536
Trapped Gene
Hsp90ab1 (ENSMUSG00000023944)
Vector Insertion
Chr 17: 45706337 - 45706418
Public Clones RRR480 (baygenomics) RRR677 (baygenomics) RRR163 (baygenomics) RRR706 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 60% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000136557 (Chr17:45706419..45706775 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGTCATCCGCAAGAACATC Chr17:45706509..45706528 60.08 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000136557 (Chr17:45706419..45706775 -)
Downstram Exon
ENSMUSE00000136550 (Chr17:45706189..45706336 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGTCATCCGCAAGAACATC Chr17:45706509..45706528 60.08 50 GCGTCGGTTAGTGGAATCTT Chr17:45706282..45706301 59.2 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000696089 Chr17:45710116..45710220 CCACCACCCTGCTCTGTACT Chr17:45710138..45710157 60.17 60
upstream ENSMUSE00000136555 Chr17:45708714..45708860 AAGTGCACCATGGAGAGGAG Chr17:45708831..45708850 60.26 55
upstream ENSMUSE00000404358 Chr17:45708362..45708568 GCCCTGGACAAGATTCGATA Chr17:45708549..45708568 60.04 50
upstream ENSMUSE00000136547 Chr17:45707967..45708126 GCAGTTTGGTGTCGGATTCT Chr17:45708081..45708100 60.12 50
upstream ENSMUSE00000136551 Chr17:45707615..45707748 AGGAGGGTCAAGGAAGTGGT Chr17:45707658..45707677 59.97 55
upstream ENSMUSE00000136553 Chr17:45707207..45707515 ATGACTGGGAGGACCACTTG Chr17:45707216..45707235 59.96 55
upstream ENSMUSE00000136557 Chr17:45706419..45706775 AGGTCATCCGCAAGAACATC Chr17:45706509..45706528 60.08 50

*** Putative Vector Insertion (Chr 17: 45706337 - 45706418) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000136550 Chr17:45706189..45706336 GCGTCGGTTAGTGGAATCTT Chr17:45706282..45706301 59.2 50
downstream ENSMUSE00000543014 Chr17:45705807..45706075 TCCCATCAAACTCCTTGAGC Chr17:45705925..45705944 60.19 50
downstream ENSMUSE00000136561 Chr17:45705178..45705511 CAGGGTTGATCTCCAGGTGT Chr17:45705330..45705349 59.96 55
downstream ENSMUSE00000657294 Chr17:45704728..45705073 TTCCAGGAGGCTTTAATCCA Chr17:45704930..45704949 59.64 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACGGACAAGTGTTCTCCAAA Chr17:45706392..45706413 60.14 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACGGACAAGTGTTCTCCAAA Chr17:45706392..45706413 60.14 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023944