Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7564
Trapped Gene
Pml (ENSMUSG00000036986)
Vector Insertion
Chr 9: 58082741 - 58094781
Public Clones (sanger) (sanger) (sanger) RRR308 (baygenomics) D155D07 (ggtc)
E044B06 (ggtc) E038F06 (ggtc) D155D07 (ggtc) E042E08 (ggtc) E027F05 (ggtc)
E044B06 (ggtc) D144G06 (ggtc) E042E08 (ggtc) (ggtc) CMHD-GT_341D1-3 (cmhd)
IST10073A3 (tigm) IST10272G6 (tigm) IST14856H4 (tigm) IST12673D10 (tigm)
IST12001A10 (tigm) IST10875A9 (tigm) IST14692D7 (tigm) IST14856H4 (tigm)
IST11668H6 (tigm) IST10875A9 (tigm)
Private Clones OST269696 (lexicon) OST260032 (lexicon) OST226014 (lexicon)
Severity of mutation (?) Insertion after 21% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000254921 (Chr9:58094782..58095245 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGTACGCGCAAGTCCAATA Chr9:58094825..58094844 59.9 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000254921 (Chr9:58094782..58095245 -)
Downstram Exon
ENSMUSE00000254901 (Chr9:58082160..58082740 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGTACGCGCAAGTCCAATA Chr9:58094825..58094844 59.9 50 TCATGCCACTGCTGAATCTC Chr9:58082608..58082627 59.95 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000485399 Chr9:58097348..58097593 TGTCGACAACAGGACTCTGC Chr9:58097424..58097443 60.03 55
upstream ENSMUSE00000254921 Chr9:58094782..58095245 CAGTACGCGCAAGTCCAATA Chr9:58094825..58094844 59.9 50

*** Putative Vector Insertion (Chr 9: 58082741 - 58094781) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000254901 Chr9:58082160..58082740 TCATGCCACTGCTGAATCTC Chr9:58082608..58082627 59.95 50
downstream ENSMUSE00000254882 Chr9:58080960..58081054 TGGTTGTCACTGGGTGAGTG Chr9:58080961..58080980 60.63 55
downstream ENSMUSE00000457341 Chr9:58078298..58078435 CATAGCCACAGGTTGGGTCT Chr9:58078348..58078367 59.99 55
downstream ENSMUSE00000254861 Chr9:58077635..58077893 GTCCTCGTTCTCCTCTGTGG Chr9:58077773..58077792 59.83 60
downstream ENSMUSE00000254833 Chr9:58077162..58077214 CAGATTCTCGGTGTCCGAAT Chr9:58077140..58077159 60.07 50
downstream ENSMUSE00000254804 Chr9:58069522..58069672 GCTGCTATCGTCCAACTCGT Chr9:58069624..58069643 60.43 55
downstream ENSMUSE00000534036 Chr9:58066349..58068376 TCAGTGTGTGGAAACGGGTA Chr9:58067039..58067058 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTCCTGGATCCTCCTCTTC Chr9:58091732..58091752 60.15 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTCCTGGATCCTCCTCTTC Chr9:58091732..58091752 60.15 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GTAATCGCCTTGCAGCACAT Chr9:58095176..58095196 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AGCCCACCATCCTGTCATAC Chr9:58092251..58092271 59.81 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036986