Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI759
Trapped Gene
Lmnb2 (ENSMUSG00000062075)
Vector Insertion
Chr 10: 80365646 - 80365956
Public Clones CJ0144 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 97% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000574690 (Chr10:80365957..80366067 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGAGGCAGAATTCGGTGAA Chr10:80365978..80365997 59.81 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000574690 (Chr10:80365957..80366067 -)
Downstram Exon
ENSMUSE00000609518 (Chr10:80364109..80365645 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGAGGCAGAATTCGGTGAA Chr10:80365978..80365997 59.81 45 GCACTAAGTTGCAGGGAAGC Chr10:80364778..80364797 60.02 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000436317 Chr10:80380709..80380990 GGATCTCCGAGAAGGAGGAG Chr10:80380724..80380743 60.29 60
upstream ENSMUSE00000609520 Chr10:80372654..80372790 GAGTGGCATCAAGACCCTGT Chr10:80372769..80372788 60.12 55
upstream ENSMUSE00000436296 Chr10:80370130..80370286 ACTGTTTCACCGGAGTGAGG Chr10:80370207..80370226 60.15 55
upstream ENSMUSE00000410365 Chr10:80369896..80370021 TTGGAGAAGGAGACGCTGAT Chr10:80369969..80369988 59.95 50
upstream ENSMUSE00000665847 Chr10:80368749..80369000 GGCCTCTGAGGGAGTATGTG Chr10:80368866..80368885 59.68 60
upstream ENSMUSE00000436282 Chr10:80367826..80367996 CGGGTAGAACTGGAGCAGAC Chr10:80367839..80367858 59.87 60
upstream ENSMUSE00000436031 Chr10:80367631..80367756 CTTTTAGGCCTCCAAAAGCA Chr10:80367632..80367651 59.47 45
upstream ENSMUSE00000288932 Chr10:80367298..80367518 AGATGCTGGACGCTAAGGAA Chr10:80367429..80367448 59.98 50
upstream ENSMUSE00000436015 Chr10:80366860..80367133 TCATCACGGATCACCATCTC Chr10:80367092..80367111 59.43 50
upstream ENSMUSE00000507292 Chr10:80366676..80366783 CAGTCTTTGGGGAACTGGAG Chr10:80366761..80366780 59.69 55
upstream ENSMUSE00000609519 Chr10:80366195..80366314 CATCAACCCTTGTGTGGAAA Chr10:80366258..80366277 59.39 45
upstream ENSMUSE00000574690 Chr10:80365957..80366067 AAGAGGCAGAATTCGGTGAA Chr10:80365978..80365997 59.81 45

*** Putative Vector Insertion (Chr 10: 80365646 - 80365956) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000609518 Chr10:80364109..80365645 GCACTAAGTTGCAGGGAAGC Chr10:80364778..80364797 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCACCTAGTAATCGCCTTGC Chr10:80365893..80365913 59.87 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTAGTGGGGCTTTGCACCTA Chr10:80365906..80365926 60.26 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000062075