Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7602
Trapped Gene
Cwf19l2 (ENSMUSG00000025898)
Vector Insertion
Chr 9: 3450152 - 3454539
Public Clones RRR447 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 70% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000153950 (Chr9:3450014..3450151 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGGGTCCGATACTTTCCTGA Chr9:3450037..3450057 59.95 47.62 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000153950 (Chr9:3450014..3450151 +)
Downstram Exon
ENSMUSE00000153952 (Chr9:3454540..3454752 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGGGTCCGATACTTTCCTGA Chr9:3450037..3450057 59.95 47.62 CAATCGCTCTTCTCCTCTGG Chr9:3454657..3454676 60.09 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000153958 Chr9:3404085..3404190 GCGAAAAGAACAGACCCGTA Chr9:3404145..3404164 60.25 50
upstream ENSMUSE00000153955 Chr9:3409966..3410076 GTAAGCGACTTCGGGATGAG Chr9:3410006..3410025 59.84 55
upstream ENSMUSE00000441274 Chr9:3411329..3411451 GAAAAAGGACAAGCATTCAAAAA Chr9:3411352..3411374 59.65 30.43
upstream ENSMUSE00000540178 Chr9:3417869..3417982 GAAGAATGTGACAGCCACGA Chr9:3417956..3417975 59.84 50
upstream ENSMUSE00000540177 Chr9:3418656..3418775 CAAATAGAGCGGGAGAAAACC Chr9:3418740..3418760 60.08 47.62
upstream ENSMUSE00000441251 Chr9:3421286..3421376 GGACAGGTCTCCCATCAAAA Chr9:3421332..3421351 59.9 50
upstream ENSMUSE00000370457 Chr9:3428668..3428783 GCGGATTAAGCTGGCTAAGA Chr9:3428686..3428705 59.59 50
upstream ENSMUSE00000153948 Chr9:3430438..3431087 TGATCCACCAGGAAGAGGAC Chr9:3431037..3431056 60.05 55
upstream ENSMUSE00000153953 Chr9:3441055..3441145 AAGTTGGGGGCCAAGATTAT Chr9:3441101..3441120 59.67 45
upstream ENSMUSE00000153946 Chr9:3442961..3443047 GCAAAAAGATTGGGCGTAGA Chr9:3443027..3443046 60.21 45
upstream ENSMUSE00000153949 Chr9:3447237..3447353 TGAGCAGCCCTAGAGAAACC Chr9:3447298..3447317 59.57 55
upstream ENSMUSE00000153950 Chr9:3450014..3450151 AAGGGTCCGATACTTTCCTGA Chr9:3450037..3450057 59.95 47.62

*** Putative Vector Insertion (Chr 9: 3450152 - 3454539) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000153952 Chr9:3454540..3454752 CAATCGCTCTTCTCCTCTGG Chr9:3454657..3454676 60.09 55
downstream ENSMUSE00000261328 Chr9:3456733..3456849 GTGGCTGCTTGATGATGTTG Chr9:3456818..3456837 60.27 50
downstream ENSMUSE00000261307 Chr9:3458734..3458889 GGAGCCATATCACCCACTTC Chr9:3458879..3458898 59.37 55
downstream ENSMUSE00000261286 Chr9:3460051..3460131 No primer for this exon
downstream ENSMUSE00000261261 Chr9:3475483..3475584 AATGATGTGGGCAAAACCTC Chr9:3475551..3475570 59.8 45
downstream ENSMUSE00000407798 Chr9:3477817..3479236 GTCACCCAAACCATGTTTCC Chr9:3478149..3478168 60.07 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCTTGGTATGGCACAGAGG Chr9:3453122..3453142 58.72 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCAAACCTTTGCATTTTGAGA Chr9:3453167..3453188 60.24 38.1 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025898