Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7604
Trapped Gene
Zfp345 (ENSMUSG00000074731)
Vector Insertion
Chr 2: 150300619 - 150310715
Public Clones RRR458 (baygenomics) RST355 (baygenomics) 5SD186H07 (ggtc) 3SD186H07 (ggtc)
IST13438H6 (tigm)
Private Clones OST368459 (lexicon) OST235169 (lexicon) OST57714 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000713796 (Chr2:150310716..150310827 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGGTTTCTCTGCGGTGTGT Chr2:150310777..150310796 59.77 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000713796 (Chr2:150310716..150310827 -)
Downstram Exon
ENSMUSE00000640256 (Chr2:150300492..150300618 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGGTTTCTCTGCGGTGTGT Chr2:150310777..150310796 59.77 50 GCAGCGAGATTCCTGTAGGT Chr2:150300475..150300494 59.46 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000713796 Chr2:150310716..150310827 AAGGTTTCTCTGCGGTGTGT Chr2:150310777..150310796 59.77 50

*** Putative Vector Insertion (Chr 2: 150300619 - 150310715) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000640256 Chr2:150300492..150300618 GCAGCGAGATTCCTGTAGGT Chr2:150300475..150300494 59.46 55
downstream ENSMUSE00000640255 Chr2:150300232..150300292 No primer for this exon
downstream ENSMUSE00000640253 Chr2:150297666..150299160 GGCTTTGCCACAATGCTTAC Chr2:150297707..150297726 60.65 50
downstream ENSMUSE00000682087 Chr2:150296727..150299160 CATGAGGAAAGCCCCTATCA Chr2:150297222..150297241 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCTCACAGTAATCGCCTTG Chr2:150301653..150301673 60.01 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAAACCGTGACTGGGAAAAC Chr2:150301649..150301669 58.93 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CCTGCCACTCAGGAGAAGAG Chr2:150304850..150304870 60.13 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CCTGCCACTCAGGAGAAGAG Chr2:150304850..150304870 60.13 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074731