Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7616
Trapped Gene
Ascc3l1 (ENSMUSG00000003660)
Vector Insertion
Chr 2: 127047991 - 127050316
Public Clones RRR503 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 34% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000497458 (Chr2:127047867..127047990 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000497458 (Chr2:127047867..127047990 +)
Downstram Exon
ENSMUSE00000496531 (Chr2:127050317..127050466 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000318988 Chr2:127034140..127034274 No primer for this exon
upstream ENSMUSE00000168832 Chr2:127034710..127034873 No primer for this exon
upstream ENSMUSE00000168834 Chr2:127036430..127036601 No primer for this exon
upstream ENSMUSE00000168823 Chr2:127037336..127037528 No primer for this exon
upstream ENSMUSE00000353245 Chr2:127038085..127038140 No primer for this exon
upstream ENSMUSE00000409020 Chr2:127040543..127040641 No primer for this exon
upstream ENSMUSE00000319406 Chr2:127041785..127041937 No primer for this exon
upstream ENSMUSE00000168814 Chr2:127042090..127042189 No primer for this exon
upstream ENSMUSE00000318956 Chr2:127042349..127042485 No primer for this exon
upstream ENSMUSE00000168827 Chr2:127042965..127043048 No primer for this exon
upstream ENSMUSE00000168848 Chr2:127043128..127043301 No primer for this exon
upstream ENSMUSE00000168812 Chr2:127043609..127043746 No primer for this exon
upstream ENSMUSE00000388259 Chr2:127044089..127044244 No primer for this exon
upstream ENSMUSE00000168855 Chr2:127044765..127044935 No primer for this exon
upstream ENSMUSE00000332106 Chr2:127047481..127047603 No primer for this exon
upstream ENSMUSE00000498413 Chr2:127047481..127047674 No primer for this exon
upstream ENSMUSE00000497458 Chr2:127047867..127047990 No primer for this exon

*** Putative Vector Insertion (Chr 2: 127047991 - 127050316) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000496531 Chr2:127050317..127050466 No primer for this exon
downstream ENSMUSE00000495639 Chr2:127050819..127050929 No primer for this exon
downstream ENSMUSE00000485009 Chr2:127051742..127051873 No primer for this exon
downstream ENSMUSE00000484164 Chr2:127052031..127052219 No primer for this exon
downstream ENSMUSE00000483282 Chr2:127052681..127052878 No primer for this exon
downstream ENSMUSE00000489948 Chr2:127053613..127053765 No primer for this exon
downstream ENSMUSE00000489029 Chr2:127053881..127053961 No primer for this exon
downstream ENSMUSE00000488107 Chr2:127054278..127054361 No primer for this exon
downstream ENSMUSE00000487170 Chr2:127054795..127054901 No primer for this exon
downstream ENSMUSE00000519155 Chr2:127055222..127055340 No primer for this exon
downstream ENSMUSE00000661620 Chr2:127055622..127055776 No primer for this exon
downstream ENSMUSE00000661619 Chr2:127055870..127056059 No primer for this exon
downstream ENSMUSE00000508851 Chr2:127056250..127056423 No primer for this exon
downstream ENSMUSE00000507938 Chr2:127057423..127057583 No primer for this exon
downstream ENSMUSE00000506932 Chr2:127058142..127058369 No primer for this exon
downstream ENSMUSE00000513799 Chr2:127058637..127058828 No primer for this exon
downstream ENSMUSE00000512985 Chr2:127058916..127059094 No primer for this exon
downstream ENSMUSE00000511949 Chr2:127059236..127059387 No primer for this exon
downstream ENSMUSE00000511000 Chr2:127060700..127060808 No primer for this exon
downstream ENSMUSE00000500544 Chr2:127061696..127061804 No primer for this exon
downstream ENSMUSE00000168836 Chr2:127062195..127062384 No primer for this exon
downstream ENSMUSE00000168853 Chr2:127062476..127062640 No primer for this exon
downstream ENSMUSE00000168830 Chr2:127063197..127063318 No primer for this exon
downstream ENSMUSE00000318944 Chr2:127063559..127063702 No primer for this exon
downstream ENSMUSE00000168852 Chr2:127063795..127063971 No primer for this exon
downstream ENSMUSE00000168843 Chr2:127064236..127064396 No primer for this exon
downstream ENSMUSE00000168813 Chr2:127064475..127064556 No primer for this exon
downstream ENSMUSE00000168819 Chr2:127065615..127065707 No primer for this exon
downstream ENSMUSE00000661618 Chr2:127065805..127066178 No primer for this exon
downstream ENSMUSE00000392179 Chr2:127065841..127065948 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAATCATGGAACATGCTGGA Chr2:127047963..127047983 58.93 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAATCATGGAACATGCTGGA Chr2:127047963..127047983 58.93 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000003660