Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7622
Trapped Gene
Nrbp1 (ENSMUSG00000029148)
Vector Insertion
Chr 5: 31549799 - 31550056
Public Clones RRR550 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 47% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000186205 (Chr5:31549715..31549798 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCGGGAAGAACAGAAGAAC Chr5:31549751..31549770 61.13 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000186205 (Chr5:31549715..31549798 +)
Downstram Exon
ENSMUSE00000186209 (Chr5:31550057..31550115 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCGGGAAGAACAGAAGAAC Chr5:31549751..31549770 61.13 55 GCACACATGCCAAAGGAGTA Chr5:31550111..31550130 59.72 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000512720 Chr5:31543237..31543375 No primer for this exon
upstream ENSMUSE00000186217 Chr5:31543317..31543375 No primer for this exon
upstream ENSMUSE00000186215 Chr5:31546136..31546364 GTGGCTCAGACCCAAAGGTA Chr5:31546189..31546208 60.11 55
upstream ENSMUSE00000718288 Chr5:31546136..31546364 GTGGCTCAGACCCAAAGGTA Chr5:31546189..31546208 60.11 55
upstream ENSMUSE00000186218 Chr5:31546539..31546661 ACCTGGCCATGGATACAGAG Chr5:31546576..31546595 59.95 55
upstream ENSMUSE00000186219 Chr5:31546831..31546932 AAAAGGTCCGTGCAGTGTTT Chr5:31546832..31546851 59.64 45
upstream ENSMUSE00000186213 Chr5:31547250..31547339 No primer for this exon
upstream ENSMUSE00000186214 Chr5:31547736..31547776 AACGCTGGTGTACACAGATCC Chr5:31547743..31547763 60.05 52.38
upstream ENSMUSE00000186203 Chr5:31548124..31548218 GCACAACGGACTCATCAAGA Chr5:31548190..31548209 59.84 50
upstream ENSMUSE00000417899 Chr5:31548695..31548718 No primer for this exon
upstream ENSMUSE00000186205 Chr5:31549715..31549798 GCCGGGAAGAACAGAAGAAC Chr5:31549751..31549770 61.13 55

*** Putative Vector Insertion (Chr 5: 31549799 - 31550056) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000186209 Chr5:31550057..31550115 GCACACATGCCAAAGGAGTA Chr5:31550111..31550130 59.72 50
downstream ENSMUSE00000186208 Chr5:31550271..31550369 AGTAGCTGGATGGCACTGCT Chr5:31550353..31550372 60.04 55
downstream ENSMUSE00000269708 Chr5:31551922..31552054 AGGGCACTTCAAACAGTGCT Chr5:31552015..31552034 59.91 50
downstream ENSMUSE00000186204 Chr5:31552262..31552367 CTGCGGGAATTTCAGCTAGT Chr5:31552342..31552361 59.48 50
downstream ENSMUSE00000186211 Chr5:31552463..31552513 TTCTAGGGCTGGTGACTGAGA Chr5:31552489..31552509 60 52.38
downstream ENSMUSE00000186216 Chr5:31552603..31552738 CCAAAGGCTGTCAGAGGGTA Chr5:31552635..31552654 60.25 55
downstream ENSMUSE00000186210 Chr5:31552917..31552970 CCACAGATTCGATGTTGCAC Chr5:31552953..31552972 60.12 50
downstream ENSMUSE00000186207 Chr5:31553054..31553117 CGGTTCAATTTGTCCTCCAG Chr5:31553094..31553113 60.49 50
downstream ENSMUSE00000186206 Chr5:31553265..31553320 No primer for this exon
downstream ENSMUSE00000510363 Chr5:31553398..31553933 GCGCGAAGGGTAATACTGAC Chr5:31553602..31553621 59.74 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGAGGTGAGGTAGCCTTGT Chr5:31549795..31549815 59.72 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGAGGTGAGGTAGCCTTGT Chr5:31549795..31549815 59.72 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029148