Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7630
Trapped Gene
Plaa (ENSMUSG00000028577)
Vector Insertion
Chr 4: 94269567 - 94269939
Public Clones RRR627 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000672145 (Chr4:94269568..94269938 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AATTCCGGCGTGTGTGTTAG Chr4:94269912..94269931 60.94 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000672145 (Chr4:94269568..94269938 -)
Downstram Exon
ENSMUSE00000406312 (Chr4:94269568..94269942 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AATTCCGGCGTGTGTGTTAG Chr4:94269912..94269931 60.94 50 CAGCAACCCTAACACACACG Chr4:94269882..94269901 60.21 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000406312 Chr4:94269568..94269942 AATTCCGGCGTGTGTGTTAG Chr4:94269912..94269931 60.94 50
upstream ENSMUSE00000672145 Chr4:94269568..94269938 AATTCCGGCGTGTGTGTTAG Chr4:94269912..94269931 60.94 50

*** Putative Vector Insertion (Chr 4: 94269567 - 94269939) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000180379 Chr4:94256572..94256765 ACTGTCCAGCGAGAAAATGC Chr4:94256590..94256609 60.41 50
downstream ENSMUSE00000672142 Chr4:94256572..94256765 ACTGTCCAGCGAGAAAATGC Chr4:94256590..94256609 60.41 50
downstream ENSMUSE00000180381 Chr4:94254178..94254278 GCATTTGTCATTCAGCCAGA Chr4:94254171..94254190 59.81 45
downstream ENSMUSE00000672141 Chr4:94254178..94254278 GCATTTGTCATTCAGCCAGA Chr4:94254171..94254190 59.81 45
downstream ENSMUSE00000180391 Chr4:94253972..94254092 TGGTCTTGTCTGCTGATCCA Chr4:94253992..94254011 60.4 50
downstream ENSMUSE00000672140 Chr4:94253972..94254092 TGGTCTTGTCTGCTGATCCA Chr4:94253992..94254011 60.4 50
downstream ENSMUSE00000180378 Chr4:94253444..94253611 CATCGTTTGCACAGGAAAGA Chr4:94253521..94253540 59.84 45
downstream ENSMUSE00000180389 Chr4:94252986..94253121 TTTCCAGTACGCAGCAACAC Chr4:94252989..94253008 59.91 50
downstream ENSMUSE00000180385 Chr4:94250524..94250693 GCTGCTCCGCATTAATATCC Chr4:94250532..94250551 59.67 50
downstream ENSMUSE00000180384 Chr4:94250105..94250262 TTTTATCCACCTCCCGTCAC Chr4:94250152..94250171 59.79 50
downstream ENSMUSE00000180388 Chr4:94249172..94249391 GCCACCTGATCCAGAAACAT Chr4:94249224..94249243 59.93 50
downstream ENSMUSE00000180387 Chr4:94245078..94245146 GTCTGCACTGTGTTGGAAGG Chr4:94245073..94245092 59.31 55
downstream ENSMUSE00000180380 Chr4:94241857..94241925 TGGTGTCCATACCTGCAGAA Chr4:94241862..94241881 60.11 50
downstream ENSMUSE00000180382 Chr4:94240673..94240774 AGCTGATCGGTAGGCACTGT Chr4:94240730..94240749 59.9 55
downstream ENSMUSE00000713168 Chr4:94238378..94238542 TCTCTTCAGGTGCAGTTCCA Chr4:94238482..94238501 59.54 50
downstream ENSMUSE00000719496 Chr4:94238378..94238542 TCTCTTCAGGTGCAGTTCCA Chr4:94238482..94238501 59.54 50
downstream ENSMUSE00000300350 Chr4:94235861..94236600 AGCTGGCTCTGATACGGAGA Chr4:94236058..94236077 60.12 55
downstream ENSMUSE00000672143 Chr4:94231830..94236600 TGACGTATGTCCCACATGCT Chr4:94232909..94232928 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTGTCACTCAGGCGGTAAT Chr4:94269884..94269904 59.17 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCGTGTGTGTTAGGGTTGCT Chr4:94269903..94269923 61.16 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028577