Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7651
Trapped Gene
Slc25a20 (ENSMUSG00000032602)
Vector Insertion
Chr 9: 108564664 - 108572096
Public Clones RRR730 (baygenomics) IST12419A4 (tigm) IST11558A8 (tigm) IST15083G2 (tigm)
Private Clones OST282402 (lexicon) OST261797 (lexicon)
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000334579 (Chr9:108564487..108564663 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000334579 (Chr9:108564487..108564663 +)
Downstram Exon
ENSMUSE00000221347 (Chr9:108572097..108572189 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GTCTTCCGGAAACAGTCCAA Chr9:108572179..108572198 60.09 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000334579 Chr9:108564487..108564663 No primer for this exon

*** Putative Vector Insertion (Chr 9: 108564664 - 108572096) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000221347 Chr9:108572097..108572189 GTCTTCCGGAAACAGTCCAA Chr9:108572179..108572198 60.09 50
downstream ENSMUSE00000221346 Chr9:108574750..108574877 AGACCAAACCCAAAGAAGCA Chr9:108574838..108574857 59.71 45
downstream ENSMUSE00000221345 Chr9:108579915..108580005 AGCATTTGATCCGTTCTCCA Chr9:108580000..108580019 60.6 45
downstream ENSMUSE00000239816 Chr9:108582418..108582535 TCCCGAACTCCTGATACAGC Chr9:108582496..108582515 60.22 55
downstream ENSMUSE00000239795 Chr9:108584303..108584375 TACATCCCACTGGCAGGAAC Chr9:108584327..108584346 60.92 55
downstream ENSMUSE00000239774 Chr9:108584678..108584787 CTGGAATCGAGACTTGAGCA Chr9:108584786..108584805 59.11 50
downstream ENSMUSE00000221349 Chr9:108585380..108585504 TGACTGCATTGAACCCTTTG Chr9:108585481..108585500 59.69 45
downstream ENSMUSE00000239730 Chr9:108586163..108586468 ATGGCAATTTCAAAGCCAAG Chr9:108586194..108586213 60.07 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATGTGCCTGGTGTTTGTGG Chr9:108567622..108567642 63.44 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTAGTCCGTGACTGGGAAAA Chr9:108567708..108567729 58.71 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032602