Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7668
Trapped Gene
Topbp1 (ENSMUSG00000032555)
Vector Insertion
Chr 9: 103231024 - 103235014
Public Clones RRS046 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 56% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000220750 (Chr9:103230737..103231023 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTAGAGCCTTCCGTGCTGTC Chr9:103230866..103230885 60.02 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000220750 (Chr9:103230737..103231023 +)
Downstram Exon
ENSMUSE00000220747 (Chr9:103235015..103235185 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTAGAGCCTTCCGTGCTGTC Chr9:103230866..103230885 60.02 60 ATTTGCCAAAGCAACTGTCA Chr9:103235125..103235144 59.32 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000448198 Chr9:103207545..103207701 GGTTCTGCAGCGTTAGCTTC Chr9:103207562..103207581 60.16 55
upstream ENSMUSE00000373288 Chr9:103208427..103208517 AAATGACCAAGAGCCGTTTC Chr9:103208442..103208461 59.17 45
upstream ENSMUSE00000319085 Chr9:103211075..103211209 TGGCACTGTTTTTGATCACC Chr9:103211182..103211201 59.55 45
upstream ENSMUSE00000319054 Chr9:103212147..103212290 TGTTGGTCCTCAAGTGGTCA Chr9:103212161..103212180 60.13 50
upstream ENSMUSE00000319015 Chr9:103213824..103214005 TACAAATGATGGGTGGACGA Chr9:103213843..103213862 59.77 45
upstream ENSMUSE00000448161 Chr9:103215102..103215298 AGCAACTCACGGCTAAGCAC Chr9:103215212..103215231 60.6 55
upstream ENSMUSE00000220754 Chr9:103217384..103217560 TACGAATGTGCCAGGAGATG Chr9:103217392..103217411 59.67 50
upstream ENSMUSE00000220755 Chr9:103220317..103220483 GCAAACTTGAATGTTCCCTTG Chr9:103220398..103220418 59.6 42.86
upstream ENSMUSE00000220757 Chr9:103222499..103222662 CAGTGGAGGTGGAGTTCGAT Chr9:103222555..103222574 60.11 55
upstream ENSMUSE00000220762 Chr9:103222804..103223051 GGAAATGACGACTCCACGAT Chr9:103223030..103223049 59.93 50
upstream ENSMUSE00000318799 Chr9:103225598..103225956 GTGACGGTGGGAGAAGTTGT Chr9:103225921..103225940 60.01 55
upstream ENSMUSE00000220756 Chr9:103226657..103226829 CAAGTCGAATCCCCTCTTCA Chr9:103226692..103226711 60.19 50
upstream ENSMUSE00000220767 Chr9:103227972..103228183 GTTTGCCGGCAGTTAACATT Chr9:103228085..103228104 60 45
upstream ENSMUSE00000220750 Chr9:103230737..103231023 GTAGAGCCTTCCGTGCTGTC Chr9:103230866..103230885 60.02 60

*** Putative Vector Insertion (Chr 9: 103231024 - 103235014) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000220747 Chr9:103235015..103235185 ATTTGCCAAAGCAACTGTCA Chr9:103235125..103235144 59.32 40
downstream ENSMUSE00000220748 Chr9:103235275..103235384 CACAACGCTGTCAAGTGGTT Chr9:103235310..103235329 59.79 50
downstream ENSMUSE00000220764 Chr9:103236386..103236509 AATAGCCAATGCTCGGACAC Chr9:103236508..103236527 60.1 50
downstream ENSMUSE00000220752 Chr9:103238142..103238288 AGATGCAGAAACTGCCAAGG Chr9:103238279..103238298 60.4 50
downstream ENSMUSE00000220753 Chr9:103238394..103238496 CCACTCCCATTCAACAGAGG Chr9:103238479..103238498 60.5 55
downstream ENSMUSE00000220759 Chr9:103240510..103240702 TGGCTGACATGATCTCTTGC Chr9:103240578..103240597 59.95 50
downstream ENSMUSE00000220768 Chr9:103244258..103244478 GTCGTCCCAAATGATCTGCT Chr9:103244330..103244349 60.08 50
downstream ENSMUSE00000220765 Chr9:103245878..103246026 TGCTACTGGAGGCTCTGGTT Chr9:103245942..103245961 60.01 55
downstream ENSMUSE00000220766 Chr9:103246255..103246366 TTCTGTGCGTCTCCTCCTGT Chr9:103246285..103246304 61.01 55
downstream ENSMUSE00000220749 Chr9:103247121..103247284 GCGTCTAGGTAGGAGCGATG Chr9:103247259..103247278 60 60
downstream ENSMUSE00000220758 Chr9:103248072..103248209 AACAATGCCGGATTCTTGAC Chr9:103248209..103248228 59.94 45
downstream ENSMUSE00000220760 Chr9:103249014..103249103 GGCCGATCAACACGTAAAAT Chr9:103249060..103249079 59.83 45
downstream ENSMUSE00000220751 Chr9:103249257..103249418 AGCCTCTGCGATGAAAACTC Chr9:103249364..103249383 59.58 50
downstream ENSMUSE00000331710 Chr9:103252112..103252762 CGAGGCCGTTTGACTACATT Chr9:103252239..103252258 60.13 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTCCTTTAATCGCCTTGCAG Chr9:103231068..103231089 60.57 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCTTCGTGACTGGGAAAAC Chr9:103234070..103234090 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032555