Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7692
Trapped Gene
Scamp5 (ENSMUSG00000040722)
Vector Insertion
Chr 9: 57299292 - 57299786
Public Clones RRS150 (baygenomics)
Private Clones OST450079 (lexicon) OST375349 (lexicon) OST364727 (lexicon) OST295993 (lexicon)
OST292037 (lexicon) OST284556 (lexicon) OST278564 (lexicon) OST223945 (lexicon)
OST181463 (lexicon) OST128088 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000698496 (Chr9:57299787..57299841 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGTGTGAGCAGGCTTACTGAG Chr9:57299808..57299828 60.07 57.14 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000698496 (Chr9:57299787..57299841 -)
Downstram Exon
ENSMUSE00000259955 (Chr9:57299163..57299291 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGTGTGAGCAGGCTTACTGAG Chr9:57299808..57299828 60.07 57.14 ATGCTGAGGAGGGATGTCTG Chr9:57299178..57299197 60.22 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000698497 Chr9:57315740..57315831 No primer for this exon
upstream ENSMUSE00000698496 Chr9:57299787..57299841 GGTGTGAGCAGGCTTACTGAG Chr9:57299808..57299828 60.07 57.14

*** Putative Vector Insertion (Chr 9: 57299292 - 57299786) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000259955 Chr9:57299163..57299291 ATGCTGAGGAGGGATGTCTG Chr9:57299178..57299197 60.22 55
downstream ENSMUSE00000464354 Chr9:57294884..57295040 AGCAGACGTAGGAGCAAGGT Chr9:57294890..57294909 59.12 55
downstream ENSMUSE00000486096 Chr9:57293879..57293980 TGAGCCATGAAGGTGAAGAA Chr9:57293908..57293927 59.37 45
downstream ENSMUSE00000259900 Chr9:57293179..57293296 TTCGTCCCGAAGAAGGAAAT Chr9:57293239..57293258 60.93 45
downstream ENSMUSE00000636581 Chr9:57289135..57291671 CAGGAAGTTGACTGGGGGTA Chr9:57289496..57289515 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000040722