Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7700
Trapped Gene
Tlk2 (ENSMUSG00000020694)
Vector Insertion
Chr 11: 105045525 - 105045609
Public Clones RRS215 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000576397 (Chr11:105045526..105045608 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000576397 (Chr11:105045526..105045608 +)
Downstram Exon
ENSMUSE00000709497 (Chr11:105045526..105045608 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000671612 Chr11:105040121..105040655 No primer for this exon
upstream ENSMUSE00000671611 Chr11:105041802..105041900 No primer for this exon
upstream ENSMUSE00000712625 Chr11:105042841..105043365 No primer for this exon
upstream ENSMUSE00000719782 Chr11:105042841..105043365 No primer for this exon
upstream ENSMUSE00000647040 Chr11:105043107..105043365 No primer for this exon

*** Putative Vector Insertion (Chr 11: 105045525 - 105045609) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000400022 Chr11:105045526..105045608 No primer for this exon
downstream ENSMUSE00000576397 Chr11:105045526..105045608 No primer for this exon
downstream ENSMUSE00000709497 Chr11:105045526..105045608 No primer for this exon
downstream ENSMUSE00000108055 Chr11:105068694..105068765 No primer for this exon
downstream ENSMUSE00000108072 Chr11:105070166..105070235 No primer for this exon
downstream ENSMUSE00000108080 Chr11:105071108..105071151 No primer for this exon
downstream ENSMUSE00000671619 Chr11:105071859..105071954 No primer for this exon
downstream ENSMUSE00000108064 Chr11:105082500..105082667 No primer for this exon
downstream ENSMUSE00000108058 Chr11:105101675..105101770 No primer for this exon
downstream ENSMUSE00000108057 Chr11:105102883..105102975 No primer for this exon
downstream ENSMUSE00000108078 Chr11:105108088..105108198 No primer for this exon
downstream ENSMUSE00000108076 Chr11:105108773..105108909 No primer for this exon
downstream ENSMUSE00000331183 Chr11:105110799..105110951 No primer for this exon
downstream ENSMUSE00000108069 Chr11:105114605..105114671 No primer for this exon
downstream ENSMUSE00000108082 Chr11:105116280..105116377 No primer for this exon
downstream ENSMUSE00000108068 Chr11:105118184..105118265 No primer for this exon
downstream ENSMUSE00000108063 Chr11:105121575..105121666 No primer for this exon
downstream ENSMUSE00000108065 Chr11:105128467..105128556 No primer for this exon
downstream ENSMUSE00000108050 Chr11:105130940..105131109 No primer for this exon
downstream ENSMUSE00000388422 Chr11:105132413..105132551 No primer for this exon
downstream ENSMUSE00000382197 Chr11:105137151..105137262 No primer for this exon
downstream ENSMUSE00000576393 Chr11:105137151..105137773 No primer for this exon
downstream ENSMUSE00000671622 Chr11:105137151..105137385 No primer for this exon
downstream ENSMUSE00000108061 Chr11:105140432..105140539 No primer for this exon
downstream ENSMUSE00000413546 Chr11:105142399..105143491 No primer for this exon
downstream ENSMUSE00000671609 Chr11:105142399..105142920 No primer for this exon
downstream ENSMUSE00000671616 Chr11:105142399..105143120 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGCTTCTTGTCCCTCTTTC Chr11:105045496..105045516 59.4 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGCTTCTTGTCCCTCTTTC Chr11:105045496..105045516 59.4 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020694