Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7728
Trapped Gene
Gtf2h3 (ENSMUSG00000029387)
Vector Insertion
Chr 5: 125044841 - 125045561
Public Clones RRN056 (baygenomics) RRG412 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 74% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000188455 (Chr5:125044772..125044840 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGGGGGACTGTACCTGAAG Chr5:125044785..125044804 59.57 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000188455 (Chr5:125044772..125044840 +)
Downstram Exon
ENSMUSE00000188454 (Chr5:125045562..125045697 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGGGGGACTGTACCTGAAG Chr5:125044785..125044804 59.57 60 AGACTGCGATGACAGAAGCA Chr5:125045662..125045681 59.73 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000425687 Chr5:125029180..125029210 No primer for this exon
upstream ENSMUSE00000321909 Chr5:125032457..125032536 AGTTGACACCAACCCGATTT Chr5:125032485..125032504 59.31 45
upstream ENSMUSE00000188456 Chr5:125033943..125034049 CTGGCGAATTCTCACCTGTT Chr5:125033979..125033998 60.26 50
upstream ENSMUSE00000188458 Chr5:125034145..125034311 GACAGTTGCAAACGAGGTGA Chr5:125034259..125034278 59.88 50
upstream ENSMUSE00000188450 Chr5:125038634..125038696 GACATCAAGGGCCAGCATAC Chr5:125038636..125038655 60.49 55
upstream ENSMUSE00000188452 Chr5:125039380..125039409 TCACAGAGTGAACAAGGCAGTT Chr5:125039384..125039405 59.95 45.46
upstream ENSMUSE00000188457 Chr5:125040359..125040387 No primer for this exon
upstream ENSMUSE00000188448 Chr5:125040878..125040952 TGAACGTCATCTTTGCTGCT Chr5:125040924..125040943 59.6 45
upstream ENSMUSE00000188459 Chr5:125042490..125042543 No primer for this exon
upstream ENSMUSE00000188455 Chr5:125044772..125044840 CTGGGGGACTGTACCTGAAG Chr5:125044785..125044804 59.57 60

*** Putative Vector Insertion (Chr 5: 125044841 - 125045561) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000188454 Chr5:125045562..125045697 AGACTGCGATGACAGAAGCA Chr5:125045662..125045681 59.73 50
downstream ENSMUSE00000188451 Chr5:125045812..125045848 No primer for this exon
downstream ENSMUSE00000340140 Chr5:125045927..125046849 GACCCAATGCTGGTCATCTT Chr5:125046420..125046439 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGCCTCAGATGCCTTCTCT Chr5:125044806..125044826 59.56 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGCCTCAGATGCCTTCTCT Chr5:125044806..125044826 59.56 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029387