Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7776
Trapped Gene
Clic4 (ENSMUSG00000037242)
Vector Insertion
Chr 4: 134794887 - 134828432
Public Clones (sanger) (sanger) (sanger) (sanger) RRM201 (baygenomics) XB010B (baygenomics)
D153H06 (ggtc) (ggtc) D057E11 (ggtc) E067G01 (ggtc) D118B06 (ggtc)
D057E11 (ggtc) E059B01 (ggtc) D058A07 (ggtc) E068G10 (ggtc) IST14959H11 (tigm)
IST15097D2 (tigm) IST14231D8 (tigm)
Private Clones OST279691 (lexicon) OST206974 (lexicon) OST174772 (lexicon) OST173704 (lexicon)
OST51867 (lexicon)
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000264663 (Chr4:134828433..134828678 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCATCGAGCTCTTCGTCAAG Chr4:134828433..134828452 59.27 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000264663 (Chr4:134828433..134828678 -)
Downstram Exon
ENSMUSE00000524581 (Chr4:134794777..134794886 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCATCGAGCTCTTCGTCAAG Chr4:134828433..134828452 59.27 50 GGTCAACGGTTGTGACACTG Chr4:134794762..134794781 60.05 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000264663 Chr4:134828433..134828678 TCATCGAGCTCTTCGTCAAG Chr4:134828433..134828452 59.27 50

*** Putative Vector Insertion (Chr 4: 134794887 - 134828432) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000524581 Chr4:134794777..134794886 GGTCAACGGTTGTGACACTG Chr4:134794762..134794781 60.05 55
downstream ENSMUSE00000264643 Chr4:134781939..134782064 ATCCGTCTTGACTTCGCTGT Chr4:134781964..134781983 59.87 50
downstream ENSMUSE00000264631 Chr4:134779379..134779485 AGTGTTCGACTCTGGGTGCT Chr4:134779424..134779443 59.91 55
downstream ENSMUSE00000496847 Chr4:134774423..134774604 GAAACCGACGTGTGGAAAAT Chr4:134774463..134774482 59.84 45
downstream ENSMUSE00000497876 Chr4:134772898..134773180 GAGGCGGAGCAGTCTGTTAG Chr4:134772925..134772944 60.16 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTTGTGGTAATCGCCTTGC Chr4:134813369..134813389 60.14 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AATTATACGTGACTGGGAAAACC Chr4:134813365..134813388 58.39 39.13 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TCCTTGTTTCATGTTGCCTTA Chr4:134813688..134813709 58.28 38.1 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TCCTTGTTTCATGTTGCCTTA Chr4:134813688..134813709 58.28 38.1 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037242