Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7781
Trapped Gene
Prep (ENSMUSG00000019849)
Vector Insertion
Chr 10: 44791934 - 44810798
Public Clones RRM213 (baygenomics)
Private Clones OST239858 (lexicon)
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000098559 (Chr10:44791859..44791933 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000098559 (Chr10:44791859..44791933 +)
Downstram Exon
ENSMUSE00000098548 (Chr10:44810799..44810932 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000354490 Chr10:44787012..44787181 No primer for this exon
upstream ENSMUSE00000098559 Chr10:44791859..44791933 No primer for this exon

*** Putative Vector Insertion (Chr 10: 44791934 - 44810798) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000098548 Chr10:44810799..44810932 No primer for this exon
downstream ENSMUSE00000098556 Chr10:44812468..44812598 No primer for this exon
downstream ENSMUSE00000098558 Chr10:44814787..44814996 No primer for this exon
downstream ENSMUSE00000098553 Chr10:44817199..44817320 No primer for this exon
downstream ENSMUSE00000098552 Chr10:44827578..44827683 No primer for this exon
downstream ENSMUSE00000386296 Chr10:44834869..44835060 No primer for this exon
downstream ENSMUSE00000098545 Chr10:44840449..44840646 No primer for this exon
downstream ENSMUSE00000098546 Chr10:44845770..44845873 No primer for this exon
downstream ENSMUSE00000098551 Chr10:44867791..44867927 No primer for this exon
downstream ENSMUSE00000098547 Chr10:44870242..44870336 No primer for this exon
downstream ENSMUSE00000440456 Chr10:44872861..44872992 No primer for this exon
downstream ENSMUSE00000440452 Chr10:44875322..44875478 No primer for this exon
downstream ENSMUSE00000643791 Chr10:44878038..44878803 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCTCTTTCTCCACTTTTGC Chr10:44809891..44809911 59.06 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCTCTTTCTCCACTTTTGC Chr10:44809891..44809911 59.06 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019849