Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7787
Trapped Gene
Med27 (ENSMUSG00000026799)
Vector Insertion
Chr 2: 29269039 - 29326812
Public Clones RRM266 (baygenomics) IST13410G12 (tigm) IST10097H11 (tigm) IST13830A1 (tigm)
IST12575H12 (tigm)
Private Clones OST406590 (lexicon) OST57561 (lexicon) OST46907 (lexicon) OST36578 (lexicon)
OST33772 (lexicon)
Severity of mutation (?) Insertion after 77% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000162923 (Chr2:29268908..29269038 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCATGCAGGTCTAGCGTCT Chr2:29268915..29268934 59.9 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000162923 (Chr2:29268908..29269038 +)
Downstram Exon
ENSMUSE00000162915 (Chr2:29326813..29326906 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCATGCAGGTCTAGCGTCT Chr2:29268915..29268934 59.9 55 TCCCATTGGGTCTCGATAAG Chr2:29326892..29326911 59.89 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000385559 Chr2:29202356..29202567 GCGTGAGTAGGGTCTTCGAC Chr2:29202444..29202463 59.87 60
upstream ENSMUSE00000162927 Chr2:29205366..29205510 ATCCTGTGCAGGACAAAACC Chr2:29205446..29205465 59.97 50
upstream ENSMUSE00000162923 Chr2:29268908..29269038 ACCATGCAGGTCTAGCGTCT Chr2:29268915..29268934 59.9 55

*** Putative Vector Insertion (Chr 2: 29269039 - 29326812) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000162915 Chr2:29326813..29326906 TCCCATTGGGTCTCGATAAG Chr2:29326892..29326911 59.89 50
downstream ENSMUSE00000697121 Chr2:29332853..29332906 AAGGGCCAGTAATGCTCTGA Chr2:29332895..29332914 59.84 50
downstream ENSMUSE00000162919 Chr2:29355739..29355846 GCTCCTCATGACCACAATGA Chr2:29355786..29355805 59.64 50
downstream ENSMUSE00000162917 Chr2:29364943..29364984 GGTAGCTGGATTTGGACCAT Chr2:29364973..29364992 58.86 50
downstream ENSMUSE00000162913 Chr2:29378294..29378371 ATGAAGGACCTGACCACGAC Chr2:29378373..29378392 59.97 55
downstream ENSMUSE00000360310 Chr2:29379887..29380308 TTCGGAAGTCTCTCCACGTC Chr2:29379989..29380008 60.39 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCACCTGCTATTGCGGTATG Chr2:29314021..29314041 59.71 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCACCTGCTATTGCGGTATG Chr2:29314021..29314041 59.71 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026799