Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7790
Trapped Gene
Ncor2 (ENSMUSG00000029478)
Vector Insertion
Chr 5: 125568337 - 125572023
Public Clones RRM275 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000189280 (Chr5:125572024..125572090 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GATGCGGAAGAAGCTGATCT Chr5:125572062..125572081 59.54 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000189280 (Chr5:125572024..125572090 -)
Downstram Exon
ENSMUSE00000189271 (Chr5:125568164..125568336 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GATGCGGAAGAAGCTGATCT Chr5:125572062..125572081 59.54 50 CCGGGAACTGTTTCTCGTAG Chr5:125568182..125568201 59.73 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000536603 Chr5:125659367..125659423 No primer for this exon
upstream ENSMUSE00000687687 Chr5:125659367..125659550 No primer for this exon
upstream ENSMUSE00000687689 Chr5:125659367..125659572 No primer for this exon
upstream ENSMUSE00000687704 Chr5:125659367..125659589 No primer for this exon
upstream ENSMUSE00000687761 Chr5:125659367..125659584 No primer for this exon
upstream ENSMUSE00000687760 Chr5:125633977..125634022 TTTGAGGAACACAGCCTCCT Chr5:125633991..125634010 59.84 50
upstream ENSMUSE00000318715 Chr5:125605140..125605270 CTACCTGGACCCTACCACCA Chr5:125605244..125605263 59.84 60
upstream ENSMUSE00000471726 Chr5:125605140..125605350 CTACCTGGACCCTACCACCA Chr5:125605244..125605263 59.84 60
upstream ENSMUSE00000719098 Chr5:125605140..125605350 CTACCTGGACCCTACCACCA Chr5:125605244..125605263 59.84 60
upstream ENSMUSE00000318709 Chr5:125599852..125599979 ATCATCCAGCCACAGAGGAG Chr5:125599894..125599913 60.22 55
upstream ENSMUSE00000687686 Chr5:125599852..125599979 ATCATCCAGCCACAGAGGAG Chr5:125599894..125599913 60.22 55
upstream ENSMUSE00000318701 Chr5:125598987..125599164 AGAATTCACCGAGAGCAAGC Chr5:125599079..125599098 59.58 50
upstream ENSMUSE00000687685 Chr5:125598987..125599164 AGAATTCACCGAGAGCAAGC Chr5:125599079..125599098 59.58 50
upstream ENSMUSE00000318694 Chr5:125590263..125590442 CTCGACTGTCCAAGGAGGAG Chr5:125590341..125590360 59.98 60
upstream ENSMUSE00000517037 Chr5:125586569..125586682 CCACCCATAGAATCAAAGCA Chr5:125586606..125586625 58.57 45
upstream ENSMUSE00000318682 Chr5:125583013..125583069 No primer for this exon
upstream ENSMUSE00000189256 Chr5:125578317..125578369 TACAACCAGCCGTCTGACAC Chr5:125578344..125578363 59.75 55
upstream ENSMUSE00000189280 Chr5:125572024..125572090 GATGCGGAAGAAGCTGATCT Chr5:125572062..125572081 59.54 50

*** Putative Vector Insertion (Chr 5: 125568337 - 125572023) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000189271 Chr5:125568164..125568336 CCGGGAACTGTTTCTCGTAG Chr5:125568182..125568201 59.73 55
downstream ENSMUSE00000189250 Chr5:125567211..125567304 TGCTCAGACAAGCCATCAAT Chr5:125567193..125567212 59.4 45
downstream ENSMUSE00000318654 Chr5:125565251..125565429 CCTGACGGTCCTTGTAGACC Chr5:125565275..125565294 59.57 60
downstream ENSMUSE00000189246 Chr5:125561500..125561554 CTCTCCAGGAATGAGGCAAT Chr5:125561482..125561501 59.24 50
downstream ENSMUSE00000189289 Chr5:125559378..125559476 CGCCTCACCAAGCTCTTGTA Chr5:125559384..125559403 61.5 55
downstream ENSMUSE00000318635 Chr5:125549302..125549447 GCTTCTCTTCCTCCTTGTCG Chr5:125549314..125549333 59.16 55
downstream ENSMUSE00000189296 Chr5:125548146..125548318 GTTGTCCTCGCCAGAAGTGT Chr5:125548263..125548282 60.31 55
downstream ENSMUSE00000189292 Chr5:125546210..125546272 TCCTCAGTCCAGCGAGAACT Chr5:125546211..125546230 60.13 55
downstream ENSMUSE00000189258 Chr5:125536103..125536245 AGCTTGTGCTGCTGAAGGAT Chr5:125536088..125536107 60.16 50
downstream ENSMUSE00000189275 Chr5:125531281..125531428 TGCTTCCATCTCTTCGTCCT Chr5:125531305..125531324 59.95 50
downstream ENSMUSE00000189249 Chr5:125529712..125529765 CCCAACTCTGGGAACCTCAT Chr5:125529706..125529725 61.28 55
downstream ENSMUSE00000189272 Chr5:125528702..125528904 CTACTGCCGGTTCTTCTGGA Chr5:125528736..125528755 60.39 55
downstream ENSMUSE00000189253 Chr5:125528575..125528697 GGGCTTCTTGTTCATCCTTG Chr5:125528625..125528644 59.67 50
downstream ENSMUSE00000189247 Chr5:125528310..125528572 AGTTTCAATGGCCTCTGTGC Chr5:125528437..125528456 60.26 50
downstream ENSMUSE00000536639 Chr5:125528310..125528904 TTTCCCACATCGATCTCCTC Chr5:125528552..125528571 60.01 50
downstream ENSMUSE00000318572 Chr5:125523115..125523235 CTTCAGCTGCTTCAGGTCCA Chr5:125523120..125523139 61.67 55
downstream ENSMUSE00000189293 Chr5:125522166..125522334 TTTGGGGGTACTGTGTCCTC Chr5:125522266..125522285 59.82 55
downstream ENSMUSE00000687688 Chr5:125522166..125522337 TTTGGGGGTACTGTGTCCTC Chr5:125522266..125522285 59.82 55
downstream ENSMUSE00000331878 Chr5:125519259..125519423 GTGGGGAAGTCTTGATCACC Chr5:125519276..125519295 59.36 55
downstream ENSMUSE00000318541 Chr5:125518231..125518367 ACCCAGCTGCCTCTCAAGTA Chr5:125518221..125518240 60.01 55
downstream ENSMUSE00000392132 Chr5:125517644..125517749 CTCTGAGTGAGGCACACGAA Chr5:125517689..125517708 60.18 55
downstream ENSMUSE00000536631 Chr5:125517644..125517746 CACGAAGCTGGACTGACATC Chr5:125517703..125517722 59.42 55
downstream ENSMUSE00000687723 Chr5:125517432..125517536 AGTGGGCACTCCCAGACTTT Chr5:125517435..125517454 61.08 55
downstream ENSMUSE00000389863 Chr5:125517191..125517288 TTGGTGATGCTTCCACTGGT Chr5:125517227..125517246 61.53 50
downstream ENSMUSE00000318514 Chr5:125516346..125516496 ATAGGACGTGGCCTTTCTTG Chr5:125516333..125516352 59.19 50
downstream ENSMUSE00000318507 Chr5:125514726..125514866 GAGCACTGTGACACGGACAT Chr5:125514820..125514839 59.74 55
downstream ENSMUSE00000189248 Chr5:125514354..125514434 GATGTGATGCTGCTCCTTGA Chr5:125514351..125514370 59.95 50
downstream ENSMUSE00000189267 Chr5:125513696..125513991 CGCCGTAAGTAGTCCTCCTG Chr5:125513924..125513943 59.89 60
downstream ENSMUSE00000189298 Chr5:125512385..125512739 CTGACCGGCTCTTCAGACTC Chr5:125512540..125512559 60.13 60
downstream ENSMUSE00000318482 Chr5:125511056..125511277 CGGGGTGTAGATGTCAGCTT Chr5:125511201..125511220 60.13 55
downstream ENSMUSE00000318478 Chr5:125510342..125510596 TGCTGCGAGGTGATGTAGTC Chr5:125510427..125510446 60.02 55
downstream ENSMUSE00000318473 Chr5:125509490..125509639 GGACAGCGGTGAGCTACTGT Chr5:125509472..125509491 60.48 60
downstream ENSMUSE00000189277 Chr5:125509252..125509383 GGATGGACTTGTCTCGTTCC Chr5:125509275..125509294 59.51 55
downstream ENSMUSE00000536617 Chr5:125508991..125509168 No primer for this exon
downstream ENSMUSE00000370521 Chr5:125508982..125509168 No primer for this exon
downstream ENSMUSE00000189288 Chr5:125507172..125507587 GGGTAGGGTAGACCCCTTCA Chr5:125507468..125507487 60.18 60
downstream ENSMUSE00000318455 Chr5:125506022..125506174 CCTTCCAAGTGGCTCTTCTC Chr5:125506023..125506042 59.01 55
downstream ENSMUSE00000189261 Chr5:125505788..125505933 CTGGAGGAGTGGGCTAGATG Chr5:125505823..125505842 59.82 60
downstream ENSMUSE00000189273 Chr5:125505379..125505572 TGGGAGGTAGAGGTCACTGG Chr5:125505413..125505432 60.1 60
downstream ENSMUSE00000189254 Chr5:125504503..125504652 TCGATACAGCAGTGGGTACG Chr5:125504504..125504523 59.74 55
downstream ENSMUSE00000189259 Chr5:125503871..125504016 CCTGCTTCTTCGACTTCACC Chr5:125503897..125503916 59.99 55
downstream ENSMUSE00000189270 Chr5:125503241..125503294 No primer for this exon
downstream ENSMUSE00000189278 Chr5:125500189..125500416 GGCATTCAGAGGGTTAAAAGC Chr5:125500243..125500263 60.09 47.62
downstream ENSMUSE00000189242 Chr5:125499181..125499360 CTTTTCGGCTGCTAGGTCTG Chr5:125499291..125499310 60.15 55
downstream ENSMUSE00000420064 Chr5:125498205..125498718 AAAGGGTTGTAGGGGAATGG Chr5:125498669..125498688 60.05 50
downstream ENSMUSE00000536607 Chr5:125497532..125498718 AAAGGGTTGTAGGGGAATGG Chr5:125498669..125498688 60.05 50
downstream ENSMUSE00000687706 Chr5:125497525..125498718 AAAGGGTTGTAGGGGAATGG Chr5:125498669..125498688 60.05 50
downstream ENSMUSE00000687702 Chr5:125497523..125498718 AAAGGGTTGTAGGGGAATGG Chr5:125498669..125498688 60.05 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGGTATCAGGGCCTAGAACA Chr5:125569042..125569062 60.09 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGGTATCAGGGCCTAGAACA Chr5:125569042..125569062 60.09 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029478