Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7803
Trapped Gene
Rilpl1 (ENSMUSG00000029392)
Vector Insertion
Chr 5: 124964527 - 124964753
Public Clones RRN303 (baygenomics) RRK495 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 47% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000322403 (Chr5:124964528..124964752 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAAGCCCTGATTGAGCAGAA Chr5:124964655..124964674 59.96 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000322403 (Chr5:124964528..124964752 -)
Downstram Exon
ENSMUSE00000687883 (Chr5:124964528..124964752 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAAGCCCTGATTGAGCAGAA Chr5:124964655..124964674 59.96 45 TCTGCTCAATCAGGGCTTTC Chr5:124964634..124964653 60.48 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000714561 Chr5:124980684..124981400 AGAGGGTCATCGACCAACAC Chr5:124980858..124980877 59.97 55
upstream ENSMUSE00000718542 Chr5:124980684..124981400 AGAGGGTCATCGACCAACAC Chr5:124980858..124980877 59.97 55
upstream ENSMUSE00000188493 Chr5:124971260..124971410 CAGCTGATGACCAACCTCAA Chr5:124971307..124971326 59.83 50
upstream ENSMUSE00000687885 Chr5:124971260..124971410 CAGCTGATGACCAACCTCAA Chr5:124971307..124971326 59.83 50
upstream ENSMUSE00000188495 Chr5:124965527..124965645 GGTGATGAAGAGGCTGAAGG Chr5:124965604..124965623 59.8 55
upstream ENSMUSE00000687884 Chr5:124965527..124965645 GGTGATGAAGAGGCTGAAGG Chr5:124965604..124965623 59.8 55
upstream ENSMUSE00000322403 Chr5:124964528..124964752 AAAGCCCTGATTGAGCAGAA Chr5:124964655..124964674 59.96 45
upstream ENSMUSE00000687883 Chr5:124964528..124964752 AAAGCCCTGATTGAGCAGAA Chr5:124964655..124964674 59.96 45

*** Putative Vector Insertion (Chr 5: 124964527 - 124964753) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000687882 Chr5:124953686..124953742 TCTGAAATCGATTCCTCTCCA Chr5:124953683..124953703 59.76 42.86
downstream ENSMUSE00000687880 Chr5:124953672..124953683 No primer for this exon
downstream ENSMUSE00000687879 Chr5:124953616..124953669 No primer for this exon
downstream ENSMUSE00000322397 Chr5:124953564..124953742 TTGGACTTGAGCTCGTTCCT Chr5:124953581..124953600 59.99 50
downstream ENSMUSE00000687878 Chr5:124953560..124953613 TAGGCCAGTTCCTCTTGCAG Chr5:124953551..124953570 60.53 55
downstream ENSMUSE00000322393 Chr5:124951849..124951941 AGGCTGGGGTATTCGATTCT Chr5:124951883..124951902 59.92 50
downstream ENSMUSE00000322382 Chr5:124943091..124943853 CGTCATCAGTCCTCAAAGCA Chr5:124943590..124943609 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCAGCAGACGAGGCTAATG Chr5:124964724..124964744 60.7 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCAGCAGACGAGGCTAATG Chr5:124964724..124964744 60.7 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029392