Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7816
Trapped Gene
Pdcd11 (ENSMUSG00000025047)
Vector Insertion
Chr 19: 47191786 - 47191809
Public Clones RRN384 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 99% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000542290 (Chr19:47191787..47191808 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000542290 (Chr19:47191787..47191808 +)
Downstram Exon
ENSMUSE00000542346 (Chr19:47191787..47191892 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CGGGGCTCTCAGAGTGAGTA Chr19:47191839..47191858 60.54 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000505829 Chr19:47165258..47165357 AGCCCTGGTCTTACCTACGC Chr19:47165267..47165286 60.65 60
upstream ENSMUSE00000542377 Chr19:47167272..47167390 CACGGAAACTCCACAAATCA Chr19:47167326..47167345 59.54 45
upstream ENSMUSE00000542376 Chr19:47168241..47168372 CCACAGAAGAAGGTCCCATT Chr19:47168245..47168264 58.99 50
upstream ENSMUSE00000542375 Chr19:47169698..47169865 TTGTGCAAGTGACCGAAGTC Chr19:47169789..47169808 59.88 50
upstream ENSMUSE00000542374 Chr19:47171345..47171506 TCTTCTCCCCTGGAATGTTG Chr19:47171367..47171386 60.04 50
upstream ENSMUSE00000542373 Chr19:47172611..47172734 CACAGTGTCAAGCCTGGAAG Chr19:47172622..47172641 59.46 55
upstream ENSMUSE00000542372 Chr19:47173181..47173362 GAAAAGCAACGGAGGAGTTG Chr19:47173230..47173249 59.85 50
upstream ENSMUSE00000542371 Chr19:47175553..47175660 AGCCCAAGAAAATGGGATCT Chr19:47175623..47175642 59.9 45
upstream ENSMUSE00000542369 Chr19:47177057..47177263 GCTAGGGGCTGTGCTAGATG Chr19:47177167..47177186 60 60
upstream ENSMUSE00000706643 Chr19:47177256..47177263 No primer for this exon
upstream ENSMUSE00000494983 Chr19:47178242..47178366 GAAAGCATTCAACGCTGAGG Chr19:47178265..47178284 60.91 50
upstream ENSMUSE00000507836 Chr19:47178242..47178278 No primer for this exon
upstream ENSMUSE00000508701 Chr19:47178284..47178366 No primer for this exon
upstream ENSMUSE00000617979 Chr19:47178523..47178583 CAATTATTGCAGCTCCATTCC Chr19:47178525..47178545 59.56 42.86
upstream ENSMUSE00000617978 Chr19:47179146..47179292 CATTTGGGATCCTGGTGAAG Chr19:47179168..47179187 60.31 50
upstream ENSMUSE00000617977 Chr19:47180787..47181038 CAGACGCACGGTGTTATCAT Chr19:47180898..47180917 59.6 50
upstream ENSMUSE00000617976 Chr19:47181501..47181641 GTGGTAAAGGTGGCAGTGCT Chr19:47181501..47181520 60.18 55
upstream ENSMUSE00000617975 Chr19:47182044..47182238 ACACCCTTCACCGAGTTCTG Chr19:47182192..47182211 60.15 55
upstream ENSMUSE00000617974 Chr19:47182913..47183083 AGGAGTATGGCGTGTTCGTC Chr19:47183025..47183044 60.14 55
upstream ENSMUSE00000617973 Chr19:47184044..47184263 AGGGTCAGACAGTCGTTGCT Chr19:47184090..47184109 59.91 55
upstream ENSMUSE00000617972 Chr19:47185451..47185600 CGTGGTCCATGAGGTGTTAG Chr19:47185506..47185525 59.01 55
upstream ENSMUSE00000617971 Chr19:47186528..47186643 CGTGGACATGTTGAAGTTGG Chr19:47186574..47186593 60 50
upstream ENSMUSE00000617970 Chr19:47187631..47188205 ACACCAGGGAATCGTACAGC Chr19:47187648..47187667 60 55
upstream ENSMUSE00000689151 Chr19:47189045..47189107 TCCCAATAAGTCACCCCAGA Chr19:47189050..47189069 60.31 50

*** Putative Vector Insertion (Chr 19: 47191786 - 47191809) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000542290 Chr19:47191787..47191808 No primer for this exon
downstream ENSMUSE00000542346 Chr19:47191787..47191892 CGGGGCTCTCAGAGTGAGTA Chr19:47191839..47191858 60.54 60
downstream ENSMUSE00000542345 Chr19:47194026..47194115 GTCCGATGTCCACTTCAAGC Chr19:47194068..47194087 60.67 55
downstream ENSMUSE00000542344 Chr19:47194283..47194385 CCCAACCTGGAACTTCTTGT Chr19:47194321..47194340 59.04 50
downstream ENSMUSE00000542343 Chr19:47194737..47194914 AAGGGAAGGAGACGGTCAGT Chr19:47194826..47194845 60.11 55
downstream ENSMUSE00000542342 Chr19:47198921..47198977 GATGACCGGAGTGACAAAGC Chr19:47198977..47198996 60.67 55
downstream ENSMUSE00000542341 Chr19:47199535..47199657 TCACGTCCTCAATGGAGTTG Chr19:47199599..47199618 59.68 50
downstream ENSMUSE00000542340 Chr19:47200796..47200918 TACTTGGCCAAACCCAGAAC Chr19:47200831..47200850 59.97 50
downstream ENSMUSE00000542339 Chr19:47201365..47201599 CTGCTCGCTCTCAGACTCCT Chr19:47201602..47201621 60.03 60
downstream ENSMUSE00000542338 Chr19:47201741..47201857 TTCCACACCACTGTCGTCTT Chr19:47201806..47201825 59.15 50
downstream ENSMUSE00000542337 Chr19:47202436..47202582 CCTCGCTGTCTGAGCTCTCT Chr19:47202562..47202581 60.03 60
downstream ENSMUSE00000542334 Chr19:47202765..47203012 CATGTACTGCAGCCAAAGGA Chr19:47202938..47202957 59.86 50
downstream ENSMUSE00000542333 Chr19:47203632..47203800 ACCCACACGTTCAGCTTCTC Chr19:47203664..47203683 60.31 55
downstream ENSMUSE00000542332 Chr19:47204119..47204272 ATCCGGTTGTACAGCTCACC Chr19:47204147..47204166 60 55
downstream ENSMUSE00000542331 Chr19:47204438..47204603 GGGGTAGGTGCTCAGTGTGT Chr19:47204538..47204557 60.03 60
downstream ENSMUSE00000472385 Chr19:47205129..47205640 AGTCCAGGTAGCGCTTGAAA Chr19:47205208..47205227 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000025047