Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI783
Trapped Gene
Mat2a (ENSMUSG00000053907)
Vector Insertion
Chr 6: 72384390 - 72384974
Public Clones CH0347 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 91% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000615638 (Chr6:72384975..72385108 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTGTCGATCTCCATTTTCCA Chr6:72385059..72385078 59.05 40 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000615638 (Chr6:72384975..72385108 -)
Downstram Exon
ENSMUSE00000615637 (Chr6:72382793..72384389 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTGTCGATCTCCATTTTCCA Chr6:72385059..72385078 59.05 40 CCAACAAGTCTGGGGAAAAA Chr6:72384233..72384252 59.94 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000429035 Chr6:72389340..72389550 AGGGGACGTTCCTCTTCACT Chr6:72389368..72389387 60.11 55
upstream ENSMUSE00000429009 Chr6:72387365..72387442 ATGCTGTCCTTGATGCACAC Chr6:72387399..72387418 59.71 50
upstream ENSMUSE00000428558 Chr6:72386989..72387111 TTGCTGGGGAAATTACATCC Chr6:72387062..72387081 59.76 45
upstream ENSMUSE00000428552 Chr6:72386411..72386523 GGTTGCCTTGGAACAACAGT Chr6:72386476..72386495 60.01 50
upstream ENSMUSE00000428543 Chr6:72386191..72386334 CCAAATTGGCTGAACTACGC Chr6:72386236..72386255 60.64 50
upstream ENSMUSE00000428538 Chr6:72385805..72386023 AGCCAAGTGGCAGATTTGTT Chr6:72385820..72385839 59.74 45
upstream ENSMUSE00000559585 Chr6:72385302..72385382 CTGACTGGCCGAAAAATCAT Chr6:72385351..72385370 60.07 45
upstream ENSMUSE00000559584 Chr6:72385231..72385296 GGACCGTTCAGCTGCTTATG Chr6:72385262..72385281 60.8 55
upstream ENSMUSE00000428529 Chr6:72385200..72385382 CTGACTGGCCGAAAAATCAT Chr6:72385351..72385370 60.07 45
upstream ENSMUSE00000615638 Chr6:72384975..72385108 TTGTCGATCTCCATTTTCCA Chr6:72385059..72385078 59.05 40

*** Putative Vector Insertion (Chr 6: 72384390 - 72384974) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000615637 Chr6:72382793..72384389 CCAACAAGTCTGGGGAAAAA Chr6:72384233..72384252 59.94 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAGATAGGGGTTTGGGACA Chr6:72384927..72384947 60.31 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAGATAGGGGTTTGGGACA Chr6:72384927..72384947 60.31 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000053907