Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7830
Trapped Gene
Gtf2h1 (ENSMUSG00000006599)
Vector Insertion
Chr 7: 54072383 - 54074491
Public Clones RRM391 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 89% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000204276 (Chr7:54072267..54072382 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000204276 (Chr7:54072267..54072382 +)
Downstram Exon
ENSMUSE00000204290 (Chr7:54074492..54074584 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000204270 Chr7:54051473..54051658 No primer for this exon
upstream ENSMUSE00000674036 Chr7:54052041..54052133 No primer for this exon
upstream ENSMUSE00000674034 Chr7:54052767..54052835 No primer for this exon
upstream ENSMUSE00000204275 Chr7:54057042..54057210 No primer for this exon
upstream ENSMUSE00000674032 Chr7:54057042..54057210 No primer for this exon
upstream ENSMUSE00000204279 Chr7:54059187..54059379 No primer for this exon
upstream ENSMUSE00000204277 Chr7:54060331..54060493 No primer for this exon
upstream ENSMUSE00000204287 Chr7:54062106..54062199 No primer for this exon
upstream ENSMUSE00000330825 Chr7:54063907..54064056 No primer for this exon
upstream ENSMUSE00000330818 Chr7:54064170..54064249 No primer for this exon
upstream ENSMUSE00000204278 Chr7:54067802..54067929 No primer for this exon
upstream ENSMUSE00000204280 Chr7:54068032..54068119 No primer for this exon
upstream ENSMUSE00000204283 Chr7:54069486..54069574 No primer for this exon
upstream ENSMUSE00000204285 Chr7:54070670..54070787 No primer for this exon
upstream ENSMUSE00000204281 Chr7:54071754..54071844 No primer for this exon
upstream ENSMUSE00000204276 Chr7:54072267..54072382 No primer for this exon

*** Putative Vector Insertion (Chr 7: 54072383 - 54074491) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000204290 Chr7:54074492..54074584 No primer for this exon
downstream ENSMUSE00000204272 Chr7:54078193..54079167 No primer for this exon
downstream ENSMUSE00000674025 Chr7:54078193..54078645 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGTAGTGGCCGAGAGGTAA Chr7:54072417..54072437 60.65 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCATTTTTGGTCTTGCTTT Chr7:54072334..54072354 59.21 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000006599