Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7853
Trapped Gene
Pcf11 (ENSMUSG00000041328)
Vector Insertion
Chr 7: 99793288 - 99794499
Public Clones RRP157 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000201529 (Chr7:99794500..99794535 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000201529 (Chr7:99794500..99794535 -)
Downstram Exon
ENSMUSE00000718326 (Chr7:99792222..99793287 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CAGGGTTCTTGCAATTCGTT Chr7:99793165..99793184 60.11 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000672333 Chr7:99818368..99818413 No primer for this exon
upstream ENSMUSE00000422327 Chr7:99817939..99818394 CTTCAATAGCAAACCGCACA Chr7:99818022..99818041 59.87 45
upstream ENSMUSE00000716708 Chr7:99817939..99818443 CTTCAATAGCAAACCGCACA Chr7:99818022..99818041 59.87 45
upstream ENSMUSE00000672332 Chr7:99817731..99818144 CTTCAATAGCAAACCGCACA Chr7:99818022..99818041 59.87 45
upstream ENSMUSE00000529636 Chr7:99814250..99814375 No primer for this exon
upstream ENSMUSE00000529634 Chr7:99812477..99812665 TTACGTTCCACATGGGATGA Chr7:99812613..99812632 59.77 45
upstream ENSMUSE00000469193 Chr7:99811972..99812166 TGGTCAGTTCCCCCAGTATC Chr7:99812119..99812138 59.78 55
upstream ENSMUSE00000471458 Chr7:99809469..99810586 AGTCAGGTGGTGACCCAAAG Chr7:99809540..99809559 60 55
upstream ENSMUSE00000517796 Chr7:99808510..99808690 AAGCAGCAGCACCGACTAAG Chr7:99808577..99808596 60.73 55
upstream ENSMUSE00000513948 Chr7:99808308..99808398 CGAGCGAACGTTTAGCATCT Chr7:99808378..99808397 60.54 50
upstream ENSMUSE00000359398 Chr7:99805818..99807376 GACATCGTGGTCAACCTGTG Chr7:99806811..99806830 60.01 55
upstream ENSMUSE00000201528 Chr7:99801660..99801759 TGGTGTTGCTCAGCCAGTAG Chr7:99801732..99801751 60.05 55
upstream ENSMUSE00000201526 Chr7:99797966..99798085 CTTCCCAAGGCATATCCTGA Chr7:99798061..99798080 60.03 50
upstream ENSMUSE00000201514 Chr7:99797436..99797541 GGAGGACGAGGATCAGAATG Chr7:99797488..99797507 59.61 55
upstream ENSMUSE00000201518 Chr7:99796452..99796635 AGGTTCACGACATCCCAGAC Chr7:99796555..99796574 59.97 55
upstream ENSMUSE00000201520 Chr7:99795438..99795593 AGAACGTGCAAAAAGCCAGT Chr7:99795539..99795558 59.92 45
upstream ENSMUSE00000201527 Chr7:99794940..99795032 CTGGGATGAAGAGGAGGAAG Chr7:99794978..99794997 58.81 55
upstream ENSMUSE00000201529 Chr7:99794500..99794535 No primer for this exon

*** Putative Vector Insertion (Chr 7: 99793288 - 99794499) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000590731 Chr7:99792765..99793287 CAGGGTTCTTGCAATTCGTT Chr7:99793165..99793184 60.11 45
downstream ENSMUSE00000718326 Chr7:99792222..99793287 CAGGGTTCTTGCAATTCGTT Chr7:99793165..99793184 60.11 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr7:99794428..99794448 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTCTTCAGATTTACCATCCATC Chr7:99794520..99794543 58.97 43.48 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041328