Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7877
Trapped Gene
Csnk1a1 (ENSMUSG00000024576)
Vector Insertion
Chr 18: 61738428 - 61739992
Public Clones RRJ635 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 84% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000143442 (Chr18:61738321..61738427 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTTGAGGAAGCTCCGGATTA Chr18:61738372..61738391 59.78 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000143442 (Chr18:61738321..61738427 +)
Downstram Exon
ENSMUSE00000702159 (Chr18:61739993..61740105 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTTGAGGAAGCTCCGGATTA Chr18:61738372..61738391 59.78 45 CTGGGCTGCTTTCTGCTTTA Chr18:61740059..61740078 60.65 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000625344 Chr18:61714993..61715527 AGCGATCAACATCACCAATG Chr18:61715503..61715522 59.53 45
upstream ENSMUSE00000291977 Chr18:61716157..61716263 GGTTGGCATCCCTCACATAC Chr18:61716243..61716262 60.2 55
upstream ENSMUSE00000143439 Chr18:61727918..61728044 GACCCAGCCTTGAAGACCTC Chr18:61727968..61727987 61.17 60
upstream ENSMUSE00000143437 Chr18:61729118..61729216 TAATGGGTATTGGGCGTCAC Chr18:61729188..61729207 60.58 50
upstream ENSMUSE00000291907 Chr18:61735064..61735203 GCATCAATGCACATCTTGGT Chr18:61735173..61735192 59.53 45
upstream ENSMUSE00000291890 Chr18:61736161..61736239 No primer for this exon
upstream ENSMUSE00000372299 Chr18:61736832..61736906 CCACTCCTGTTGAGGTGTTGT Chr18:61736881..61736901 60.06 52.38
upstream ENSMUSE00000143442 Chr18:61738321..61738427 TTTGAGGAAGCTCCGGATTA Chr18:61738372..61738391 59.78 45

*** Putative Vector Insertion (Chr 18: 61738428 - 61739992) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000371770 Chr18:61739993..61740141 CTGGGCTGCTTTCTGCTTTA Chr18:61740059..61740078 60.65 50
downstream ENSMUSE00000702159 Chr18:61739993..61740105 CTGGGCTGCTTTCTGCTTTA Chr18:61740059..61740078 60.65 50
downstream ENSMUSE00000702152 Chr18:61740390..61740394 No primer for this exon
downstream ENSMUSE00000353346 Chr18:61747080..61749035 TTAGGGAAAGCTGGACATGG Chr18:61748244..61748263 60.07 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTATTCCGCATCCTTTTCA Chr18:61738408..61738428 60.17 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTATTCCGCATCCTTTTCA Chr18:61738408..61738428 60.17 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024576