Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7886
Trapped Gene
Sall1 (ENSMUSG00000031665)
Vector Insertion
Chr 8: 91552718 - 91553842
Public Clones RRM007 (baygenomics) IST12968G8 (tigm) IST12656G10 (tigm) IST13125D7 (tigm)
IST12656G10 (tigm) IST13125D7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 89% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000211596 (Chr8:91553843..91557297 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCCATCCCTATTAGCCATT Chr8:91555624..91555643 60 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000211596 (Chr8:91553843..91557297 -)
Downstram Exon
ENSMUSE00000243441 (Chr8:91551147..91552717 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCCATCCCTATTAGCCATT Chr8:91555624..91555643 60 50 CAGAGATCTCGTTGGCCTTC Chr8:91552470..91552489 59.95 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000488541 Chr8:91567929..91568061 AACTAAGCCGAGGACCAAGC Chr8:91567998..91568017 60.76 55
upstream ENSMUSE00000243454 Chr8:91566251..91566343 CAAGCGAAGCCTCAACATTT Chr8:91566292..91566311 60.39 45
upstream ENSMUSE00000211596 Chr8:91553843..91557297 CCCCATCCCTATTAGCCATT Chr8:91555624..91555643 60 50

*** Putative Vector Insertion (Chr 8: 91552718 - 91553842) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000243441 Chr8:91551147..91552717 CAGAGATCTCGTTGGCCTTC Chr8:91552470..91552489 59.95 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAATCTGAAGGTACCCGCTCT Chr8:91553830..91553851 60.63 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAATCTGAAGGTACCCGCTCT Chr8:91553830..91553851 60.63 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ATAATCGCCTTGCAGCACAT Chr8:91551228..91551248 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CCCCACTAAGAGCAAGGATG Chr8:91551248..91551268 59.69 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031665