Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI789
Trapped Gene
Tmem199 (ENSMUSG00000051232)
Vector Insertion
Chr 11: 78323924 - 78325398
Public Clones (sanger) CH0319 (sanger) (ggtc) IST14883F1 (tigm) IST10887H4 (tigm)
Private Clones OST180742 (lexicon) OST175241 (lexicon) OST168837 (lexicon) OST123316 (lexicon)
Severity of mutation (?) Insertion after 34% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000392995 (Chr11:78325399..78325633 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGCATCAGCACCTGAGAGA Chr11:78325404..78325423 60.29 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000392995 (Chr11:78325399..78325633 -)
Downstram Exon
ENSMUSE00000367221 (Chr11:78323850..78323923 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGCATCAGCACCTGAGAGA Chr11:78325404..78325423 60.29 55 GGGAGGCTTCACAATCTCTG Chr11:78323831..78323850 59.8 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000392995 Chr11:78325399..78325633 CTGCATCAGCACCTGAGAGA Chr11:78325404..78325423 60.29 55

*** Putative Vector Insertion (Chr 11: 78323924 - 78325398) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000367221 Chr11:78323850..78323923 GGGAGGCTTCACAATCTCTG Chr11:78323831..78323850 59.8 55
downstream ENSMUSE00000394610 Chr11:78323227..78323316 ATTGCGAGTGATCCGCTTAT Chr11:78323217..78323236 59.7 45
downstream ENSMUSE00000369323 Chr11:78322155..78322197 CTTGCTTTCCCAGGTCACTG Chr11:78322133..78322152 60.82 55
downstream ENSMUSE00000396709 Chr11:78321821..78321933 TGAAGATGGTGACGACCAGA Chr11:78321876..78321895 60.25 50
downstream ENSMUSE00000350943 Chr11:78320558..78321307 TAGACCCCAAAATGGACCAG Chr11:78320914..78320933 59.78 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGCATCAGCACCTGAGAGA Chr11:78325402..78325422 60.29 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGCATCAGCACCTGAGAGA Chr11:78325402..78325422 60.29 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TCACCTGATCAGAGCGTGAG Chr11:78325614..78325634 60.14 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TCACCTGATCAGAGCGTGAG Chr11:78325614..78325634 60.14 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000051232