Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7894
Trapped Gene
Lrrfip2 (ENSMUSG00000032497)
Vector Insertion
Chr 9: 111063806 - 111063894
Public Clones RRM042 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000220179 (Chr9:111063807..111063893 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGAACGACAGCAGAGAGAG Chr9:111063874..111063893 59.28 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000220179 (Chr9:111063807..111063893 +)
Downstram Exon
ENSMUSE00000633921 (Chr9:111063807..111063899 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGAACGACAGCAGAGAGAG Chr9:111063874..111063893 59.28 55 CCTCTCTCTGCTGTCGTTCC Chr9:111063897..111063916 60.13 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000633933 Chr9:111020639..111020893 CGAGGAGCCCTTCTTTTTGT Chr9:111020743..111020762 60.73 50
upstream ENSMUSE00000633932 Chr9:111022144..111022215 ATGTCATTGGGAAGGAGAGC Chr9:111022183..111022202 59.09 50
upstream ENSMUSE00000382391 Chr9:111043694..111043836 AGATGGGGACTCCTGGTTCT Chr9:111043745..111043764 59.93 55

*** Putative Vector Insertion (Chr 9: 111063806 - 111063894) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000220179 Chr9:111063807..111063893 ATGCGGATGTCTCTTGCTTC Chr9:111063868..111063887 60.37 50
downstream ENSMUSE00000633921 Chr9:111063807..111063899 CCTCTCTCTGCTGTCGTTCC Chr9:111063897..111063916 60.13 60
downstream ENSMUSE00000633920 Chr9:111065361..111065405 ATTTCCGGTCAAAGGAATGA Chr9:111065385..111065404 59.36 40
downstream ENSMUSE00000633919 Chr9:111069553..111069609 TGACCAGACCGGTGAGAGTA Chr9:111069596..111069615 59.26 55
downstream ENSMUSE00000220175 Chr9:111069704..111069748 CAAGGCTCCGAAGAGACAAT Chr9:111069740..111069759 59.43 50
downstream ENSMUSE00000633918 Chr9:111075585..111075626 TGACGAAACTCTTGATGGTCTG Chr9:111075624..111075645 60.29 45.46
downstream ENSMUSE00000633917 Chr9:111078281..111078346 CCCATGGGTGTGACTGTAAG Chr9:111078310..111078329 58.85 55
downstream ENSMUSE00000633916 Chr9:111079746..111079820 No primer for this exon
downstream ENSMUSE00000633915 Chr9:111081548..111081601 GCTCTGACTCTTGGGTGTCC Chr9:111081601..111081620 59.84 60
downstream ENSMUSE00000633914 Chr9:111081681..111081725 No primer for this exon
downstream ENSMUSE00000633913 Chr9:111082377..111082424 TCCGCCATCATACAGAGATG Chr9:111082400..111082419 59.63 50
downstream ENSMUSE00000633912 Chr9:111082720..111082776 CTGCTTCTGGAGGAACTTGC Chr9:111082772..111082791 60.13 55
downstream ENSMUSE00000633911 Chr9:111085323..111085391 ACTGGCACGATCAGAAGACA Chr9:111085373..111085392 59.42 50
downstream ENSMUSE00000633910 Chr9:111086694..111086783 CCCTACGATTGGAGCGACTA Chr9:111086736..111086755 60.23 55
downstream ENSMUSE00000220186 Chr9:111091266..111091310 No primer for this exon
downstream ENSMUSE00000220180 Chr9:111092672..111092788 TACCCCGTCTGGATGAGTTC Chr9:111092738..111092757 59.93 55
downstream ENSMUSE00000633909 Chr9:111095551..111095622 CTTAAGGCCCTGCATGTACC Chr9:111095616..111095635 59.59 55
downstream ENSMUSE00000529078 Chr9:111102169..111102339 GGACACCATGGCTTTCTTGT Chr9:111102219..111102238 59.97 50
downstream ENSMUSE00000302618 Chr9:111108259..111108351 GGCCTTCTTTGAGTTCATCC Chr9:111108328..111108347 58.72 50
downstream ENSMUSE00000633907 Chr9:111110301..111110393 CAGGGTCTCTTGGAGGTCAA Chr9:111110372..111110391 60.23 55
downstream ENSMUSE00000633906 Chr9:111116317..111116418 AGCACATCTCGCTCATTCCT Chr9:111116375..111116394 59.98 50
downstream ENSMUSE00000302583 Chr9:111116645..111116777 CTCCTGCTGACTCCAAGACC Chr9:111116768..111116787 59.99 60
downstream ENSMUSE00000220177 Chr9:111118433..111118482 GCAAGCTTTCGTAGCCTCAC Chr9:111118457..111118476 60.16 55
downstream ENSMUSE00000220174 Chr9:111122186..111122306 GCATCTCGATGAACTGCAAG Chr9:111122306..111122325 59.55 50
downstream ENSMUSE00000220185 Chr9:111124662..111124741 No primer for this exon
downstream ENSMUSE00000220178 Chr9:111125770..111125874 TCTCGCTGTAGCTTCCTCCT Chr9:111125876..111125895 59.33 55
downstream ENSMUSE00000633929 Chr9:111126454..111127829 GAAGGCACTTGGGTTTTTGA Chr9:111126939..111126958 60.09 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGAAGCAAGGCTAGCAGCAA Chr9:111063810..111063830 60.43 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAAGCAAGGCTAGCAGCAA Chr9:111063810..111063830 60.43 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032497