Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7898
Trapped Gene
Magi3 (ENSMUSG00000052539)
Vector Insertion
Chr 3: 103824345 - 103824859
Public Clones RRM055 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 90% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000421364 (Chr3:103824860..103824986 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGATTTCAGTTGTGGGCAGT Chr3:103824872..103824891 59.14 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000421364 (Chr3:103824860..103824986 -)
Downstram Exon
ENSMUSE00000421359 (Chr3:103824201..103824344 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGATTTCAGTTGTGGGCAGT Chr3:103824872..103824891 59.14 45 CAGCCCCATGTTGTACTCCT Chr3:103824233..103824252 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000588029 Chr3:104023568..104023950 GGGACACTCTGGCTGTCATC Chr3:104023611..104023630 60.69 60
upstream ENSMUSE00000709963 Chr3:104023568..104024026 GGGACACTCTGGCTGTCATC Chr3:104023611..104023630 60.69 60
upstream ENSMUSE00000721758 Chr3:104023568..104024161 GGGACACTCTGGCTGTCATC Chr3:104023611..104023630 60.69 60
upstream ENSMUSE00000510506 Chr3:103909654..103909770 No primer for this exon
upstream ENSMUSE00000511539 Chr3:103898988..103899107 AAGTCCCAGGGGTGGATTAT Chr3:103899061..103899080 59.51 50
upstream ENSMUSE00000520382 Chr3:103893382..103893591 GCAGAGCCTAGTCCTTTCCA Chr3:103893543..103893562 59.57 55
upstream ENSMUSE00000521375 Chr3:103889131..103889308 TGGCCTACACTGACACAGGA Chr3:103889148..103889167 60.31 55
upstream ENSMUSE00000565676 Chr3:103884060..103884139 CCTCGTCTCTGCAAGAAAGC Chr3:103884089..103884108 60.28 55
upstream ENSMUSE00000421469 Chr3:103865555..103865612 CCCTATGGCTGGGAGAAAAT Chr3:103865588..103865607 60.28 50
upstream ENSMUSE00000421484 Chr3:103860436..103860530 GGCTGAAATTCATTCTGCAA Chr3:103860442..103860461 58.85 40
upstream ENSMUSE00000421384 Chr3:103858265..103858453 ACTTTACTCGGGACCCATCC Chr3:103858419..103858438 60.19 55
upstream ENSMUSE00000421452 Chr3:103854716..103855321 CATCAATGGCAACTGTGTCC Chr3:103855286..103855305 59.97 50
upstream ENSMUSE00000421379 Chr3:103853067..103853098 No primer for this exon
upstream ENSMUSE00000467192 Chr3:103850779..103850935 CCCCAAAATTGGATCCTTCT Chr3:103850819..103850838 60.12 45
upstream ENSMUSE00000421444 Chr3:103847135..103847226 TTCAGGGTGCTAGGAGGAGA Chr3:103847151..103847170 59.94 55
upstream ENSMUSE00000421432 Chr3:103842460..103842652 TATATTGGGGCCATCATTCC Chr3:103842630..103842649 59.44 45
upstream ENSMUSE00000421425 Chr3:103837929..103838111 CAGAGCTTCCAACCAGGTCT Chr3:103838026..103838045 59.45 55
upstream ENSMUSE00000421420 Chr3:103831721..103831906 GGGTCATAGACGGAAGTCCA Chr3:103831866..103831885 59.93 55
upstream ENSMUSE00000477061 Chr3:103825698..103825800 AACCACATACCTGGGGACAG Chr3:103825698..103825717 59.7 55
upstream ENSMUSE00000421364 Chr3:103824860..103824986 TGATTTCAGTTGTGGGCAGT Chr3:103824872..103824891 59.14 45

*** Putative Vector Insertion (Chr 3: 103824345 - 103824859) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000421359 Chr3:103824201..103824344 CAGCCCCATGTTGTACTCCT Chr3:103824233..103824252 59.99 55
downstream ENSMUSE00000421355 Chr3:103821424..103821562 TGAGCTCAATTGCTCGAGTG Chr3:103821468..103821487 60.29 50
downstream ENSMUSE00000565679 Chr3:103820569..103820615 GTAGGAGCACAGACCGGAAG Chr3:103820565..103820584 59.87 60
downstream ENSMUSE00000565678 Chr3:103820525..103820564 GACCAAGAAAAGCCCTGAAA Chr3:103820521..103820540 59.29 45
downstream ENSMUSE00000636938 Chr3:103820525..103820615 GTAGGAGCACAGACCGGAAG Chr3:103820565..103820584 59.87 60
downstream ENSMUSE00000722170 Chr3:103820392..103820615 GTAGGAGCACAGACCGGAAG Chr3:103820565..103820584 59.87 60
downstream ENSMUSE00000636936 Chr3:103819184..103819991 GGCGGCTGTTCATCATAAAT Chr3:103819912..103819931 59.93 45
downstream ENSMUSE00000565677 Chr3:103818892..103819991 TCTGCCTTTGTGATCGTCTG Chr3:103819026..103819045 59.98 50
downstream ENSMUSE00000708009 Chr3:103817548..103819991 TGTCATAACGGGCCAGTACA Chr3:103817578..103817597 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCGGCACAATCAGGTAAACA Chr3:103824851..103824871 60.11 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCGGCACAATCAGGTAAACA Chr3:103824851..103824871 60.11 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000052539