Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7908
Trapped Gene
Vps26a (ENSMUSG00000020078)
Vector Insertion
Chr 10: 61949225 - 61949405
Public Clones RRM083 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000710299 (Chr10:61949406..61949506 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000710299 (Chr10:61949406..61949506 -)
Downstram Exon
ENSMUSE00000575952 (Chr10:61949126..61949224 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000710299 Chr10:61949406..61949506 No primer for this exon
upstream ENSMUSE00000722244 Chr10:61949406..61949506 No primer for this exon

*** Putative Vector Insertion (Chr 10: 61949225 - 61949405) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000575952 Chr10:61949126..61949224 No primer for this exon
downstream ENSMUSE00000612804 Chr10:61943306..61943455 No primer for this exon
downstream ENSMUSE00000612810 Chr10:61943306..61943455 No primer for this exon
downstream ENSMUSE00000612803 Chr10:61933808..61933883 No primer for this exon
downstream ENSMUSE00000612809 Chr10:61933808..61933883 No primer for this exon
downstream ENSMUSE00000612802 Chr10:61932649..61932805 No primer for this exon
downstream ENSMUSE00000612808 Chr10:61932649..61932805 No primer for this exon
downstream ENSMUSE00000100400 Chr10:61931038..61931202 No primer for this exon
downstream ENSMUSE00000612807 Chr10:61927380..61927486 No primer for this exon
downstream ENSMUSE00000612806 Chr10:61926439..61926507 No primer for this exon
downstream ENSMUSE00000612805 Chr10:61921672..61921814 No primer for this exon
downstream ENSMUSE00000456418 Chr10:61918025..61919606 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTCTGAGGGAAAGCCGAGT Chr10:61949434..61949454 60.89 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTCTGAGGGAAAGCCGAGT Chr10:61949434..61949454 60.89 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020078