Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7945
Trapped Gene
Wdr6 (ENSMUSG00000066357)
Vector Insertion
Chr 9: 108476332 - 108476431
Public Clones RRJ458 (baygenomics) XK593 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 76% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000240681 (Chr9:108476432..108478913 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGTTACGAGGAGCTGCTTT Chr9:108477657..108477676 60.01 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000240681 (Chr9:108476432..108478913 -)
Downstram Exon
ENSMUSE00000240659 (Chr9:108476236..108476331 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGTTACGAGGAGCTGCTTT Chr9:108477657..108477676 60.01 50 CCAGGCCTATCGTTGTCAAG Chr9:108476265..108476284 60.65 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000331581 Chr9:108480825..108480957 TCATACTCCTCCCGGTTACG Chr9:108480859..108480878 59.95 55
upstream ENSMUSE00000240681 Chr9:108476432..108478913 TGGTTACGAGGAGCTGCTTT Chr9:108477657..108477676 60.01 50

*** Putative Vector Insertion (Chr 9: 108476332 - 108476431) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000240659 Chr9:108476236..108476331 CCAGGCCTATCGTTGTCAAG Chr9:108476265..108476284 60.65 55
downstream ENSMUSE00000240629 Chr9:108476025..108476141 GCTGGTTAGGTGCCTCATGT Chr9:108476007..108476026 60.14 55
downstream ENSMUSE00000221376 Chr9:108475820..108475938 GGCTAGGCTGCCATCTGTAG Chr9:108475874..108475893 60 60
downstream ENSMUSE00000514800 Chr9:108474649..108475744 GCTGGTCTATGGAGGCTGAG Chr9:108475426..108475445 59.97 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAAAGTAATCGCCTTGCAG Chr9:108476366..108476386 59.85 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGGCGTGAGAGGGTTATAG Chr9:108476385..108476405 60.84 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000066357