Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7950
Trapped Gene
Klhl2 (ENSMUSG00000031605)
Vector Insertion
Chr 8: 67233200 - 67236888
Public Clones RRJ583 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 52% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000520206 (Chr8:67236889..67237038 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCAGTGCGTGCAAAGATTA Chr8:67236989..67237008 59.64 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000520206 (Chr8:67236889..67237038 -)
Downstram Exon
ENSMUSE00000465337 (Chr8:67233082..67233199 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCAGTGCGTGCAAAGATTA Chr8:67236989..67237008 59.64 45 TCGTAGCATTCCACACTTCG Chr8:67233119..67233138 59.86 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000582122 Chr8:67373531..67373716 GAGGAGCCACAATGGAGACG Chr8:67373548..67373567 63.13 60
upstream ENSMUSE00000582121 Chr8:67358342..67358467 CCCTCGATTCAAAAGACGAG Chr8:67358422..67358441 59.81 50
upstream ENSMUSE00000582120 Chr8:67346891..67346997 GTCACGATTGTGGCAGAAGA Chr8:67346959..67346978 59.84 50
upstream ENSMUSE00000683316 Chr8:67335580..67335701 GGATGCTGGTCGATTACGTT Chr8:67335619..67335638 59.96 50
upstream ENSMUSE00000431005 Chr8:67258495..67258657 TAAGGCCAACACGTATGCAG Chr8:67258495..67258514 59.75 50
upstream ENSMUSE00000430997 Chr8:67242920..67243029 GTTTCTTAACCTCGGCATCG Chr8:67242976..67242995 59.71 50
upstream ENSMUSE00000430994 Chr8:67238530..67238646 GCCTGGGTAAACCACGATAA Chr8:67238609..67238628 59.82 50
upstream ENSMUSE00000520206 Chr8:67236889..67237038 AGCAGTGCGTGCAAAGATTA Chr8:67236989..67237008 59.64 45

*** Putative Vector Insertion (Chr 8: 67233200 - 67236888) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000465337 Chr8:67233082..67233199 TCGTAGCATTCCACACTTCG Chr8:67233119..67233138 59.86 50
downstream ENSMUSE00000463273 Chr8:67231446..67231643 CTTTCACGGGGTCATAGGAA Chr8:67231529..67231548 59.93 50
downstream ENSMUSE00000461258 Chr8:67230526..67230627 ACACTGCTCCTCCTCGTGTT Chr8:67230524..67230543 59.91 55
downstream ENSMUSE00000491580 Chr8:67228492..67228620 TCCACTCGTTTGCAGTAGCA Chr8:67228509..67228528 60.6 50
downstream ENSMUSE00000492527 Chr8:67227829..67227969 CAACCTGTCTCCAGGCATTT Chr8:67227837..67227856 60.11 50
downstream ENSMUSE00000494791 Chr8:67221752..67221895 CATCATCTCCTCCGACAACA Chr8:67221826..67221845 59.63 50
downstream ENSMUSE00000683313 Chr8:67218660..67219771 GCGACTGTTGCCTAAAGACC Chr8:67219452..67219471 59.88 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTTCGAGTAATCGCCTTGC Chr8:67233825..67233845 59.48 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCATACTTCGAGCGTGACTG Chr8:67233829..67233849 59.62 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031605