Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI7975
Trapped Gene
Cmc1 (ENSMUSG00000039163)
Vector Insertion
Chr 9: 117984331 - 118024457
Public Clones (sanger) RRI288 (baygenomics) IST11531F6 (tigm) IST11532F5 (tigm)
IST11524F5 (tigm) IST10460D2 (tigm)
Private Clones OST348943 (lexicon) OST225392 (lexicon) OST61820 (lexicon) OST47466 (lexicon)
Severity of mutation (?) Insertion after 35% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000326934 (Chr9:118024458..118024547 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGAAAGGTGCTCCGAACAA Chr9:118024465..118024484 60.38 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000326934 (Chr9:118024458..118024547 -)
Downstram Exon
ENSMUSE00000326914 (Chr9:117984240..117984330 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGAAAGGTGCTCCGAACAA Chr9:118024465..118024484 60.38 50 AAGGATCCCAGAGTCCTTGC Chr9:117984274..117984293 60.6 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000688922 Chr9:118059135..118059198 GTGAGTGGCTTGCTGCTTCT Chr9:118059166..118059185 60.74 55
upstream ENSMUSE00000326934 Chr9:118024458..118024547 GAGAAAGGTGCTCCGAACAA Chr9:118024465..118024484 60.38 50

*** Putative Vector Insertion (Chr 9: 117984331 - 118024457) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000326914 Chr9:117984240..117984330 AAGGATCCCAGAGTCCTTGC Chr9:117984274..117984293 60.6 55
downstream ENSMUSE00000633728 Chr9:117974213..117974466 CGTAAGACGGGACTTCCTGA Chr9:117974292..117974311 60.25 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTAATCGCCTTGCAGCACA Chr9:118021388..118021408 61.9 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATTTAGCGTGACTGGGAAAAC Chr9:118018391..118018412 58.25 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ATTAATCGCCTTGCAGCACAT Chr9:118021478..118021499 61.86 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ACCTCTATTCTGTGGCAAAACA Chr9:118021543..118021565 58.77 40.91 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039163