Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI800
Trapped Gene
AC113019.13 (ENSMUSG00000078669)
Vector Insertion
Chr 7: 82679738 - 82714769
Public Clones CH0266 (sanger) AF0454 (sanger) AE0301 (sanger) AC0258 (sanger)
Private Clones OST297969 (lexicon) OST149572 (lexicon) OST116395 (lexicon) OST68100 (lexicon)
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000634166 (Chr7:82679694..82679737 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTGGGTCATGAAACTTAGTCC Chr7:82679697..82679718 59.86 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000634166 (Chr7:82679694..82679737 +)
Downstram Exon
ENSMUSE00000634165 (Chr7:82714770..82714917 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTGGGTCATGAAACTTAGTCC Chr7:82679697..82679718 59.86 50 GACTTTCCGGGTACTTGTGC Chr7:82714889..82714908 59.6 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000634167 Chr7:82600443..82600634 CTCTTGGGCTCGGTTGAGAC Chr7:82600486..82600505 62.28 60
upstream ENSMUSE00000634166 Chr7:82679694..82679737 CCTGGGTCATGAAACTTAGTCC Chr7:82679697..82679718 59.86 50

*** Putative Vector Insertion (Chr 7: 82679738 - 82714769) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000634165 Chr7:82714770..82714917 GACTTTCCGGGTACTTGTGC Chr7:82714889..82714908 59.6 55
downstream ENSMUSE00000634163 Chr7:82724388..82724684 CAGGTGTCTGAATGCCAGTG Chr7:82724638..82724657 60.31 55
downstream ENSMUSE00000634162 Chr7:82731043..82731226 CCTTCCTTGTTGTGGATGCT Chr7:82731166..82731185 60.11 50
downstream ENSMUSE00000634161 Chr7:82747672..82748187 ATGGGGTTCACGATGTGACT Chr7:82747810..82747829 60.25 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCCCCCAAATTCAGAAATA Chr7:82685758..82685778 60.26 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCCCCCAAATTCAGAAATA Chr7:82685758..82685778 60.26 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078669