Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8009
Trapped Gene
Wdr34 (ENSMUSG00000039715)
Vector Insertion
Chr 2: 29893947 - 29904203
Public Clones (sanger) RRI494 (baygenomics) (ggtc) IST14857C6 (tigm) IST14336G10 (tigm)
IST14147E10 (tigm) IST14442C12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000711889 (Chr2:29904204..29904399 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000711889 (Chr2:29904204..29904399 -)
Downstram Exon
ENSMUSE00000696764 (Chr2:29893695..29893946 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TCTGCCAGTTGTTGTTCAGC Chr2:29893723..29893742 60.03 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000711889 Chr2:29904204..29904399 No primer for this exon
upstream ENSMUSE00000714590 Chr2:29904204..29904399 No primer for this exon

*** Putative Vector Insertion (Chr 2: 29893947 - 29904203) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000286799 Chr2:29893695..29893946 TCTGCCAGTTGTTGTTCAGC Chr2:29893723..29893742 60.03 50
downstream ENSMUSE00000696764 Chr2:29893695..29893946 TCTGCCAGTTGTTGTTCAGC Chr2:29893723..29893742 60.03 50
downstream ENSMUSE00000286790 Chr2:29890283..29890392 ACAGAGCCTGTCGAGTTCCA Chr2:29890282..29890301 61.01 55
downstream ENSMUSE00000286778 Chr2:29889326..29889483 CACCACTACTGATGGCTGCT Chr2:29889365..29889384 58.91 55
downstream ENSMUSE00000286767 Chr2:29888794..29888903 TGTCAGACCTGTACGCCAAA Chr2:29888802..29888821 60.3 50
downstream ENSMUSE00000286759 Chr2:29888270..29888437 AGAGCAACACCTTGCCATCT Chr2:29888337..29888356 59.87 50
downstream ENSMUSE00000286753 Chr2:29887922..29888154 ACGAAAAGGCTGGAGTCAAA Chr2:29888062..29888081 59.85 45
downstream ENSMUSE00000286744 Chr2:29887593..29887750 CAGTGAGGTAAGGGGCTGAG Chr2:29887650..29887669 59.86 60
downstream ENSMUSE00000337969 Chr2:29887159..29887492 TGATCCAAGTCCTCCACCTC Chr2:29887257..29887276 60.05 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAAAAGGAAGTGGGAATGCT Chr2:29895186..29895206 59.17 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAAAAGGAAGTGGGAATGCT Chr2:29895186..29895206 59.17 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TTGTGTGGTGTGGAGTTGCT Chr2:29895394..29895414 60.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TTGTGTGGTGTGGAGTTGCT Chr2:29895394..29895414 60.2 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039715