Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8019
Trapped Gene
Arid3b (ENSMUSG00000004661)
Vector Insertion
Chr 9: 57658288 - 57681422
Public Clones (sanger) RRJ028 (baygenomics) (ggtc) (ggtc) (cmhd)
PST20183-NR (escells) PST20631-NR (escells) PST24091-NR (escells) PST23091-NR (escells)
PST17793-NR (escells) PST22884-NR (escells) PST22826-NR (escells) PST24787-NR (escells)
PST17468-NL (escells) IST12298H12 (tigm) IST14829F8 (tigm) IST13787H9 (tigm)
IST11386D12 (tigm) IST14054C3 (tigm) IST14133A7 (tigm) IST14217F2 (tigm)
IST11726B8 (tigm) IST11726B8 (tigm)
Private Clones OST449095 (lexicon) OST424270 (lexicon) OST412485 (lexicon) OST369938 (lexicon)
OST286169 (lexicon) OST174628 (lexicon)
Severity of mutation (?) Insertion after 63% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000478601 (Chr9:57681423..57682039 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000478601 (Chr9:57681423..57682039 -)
Downstram Exon
ENSMUSE00000464653 (Chr9:57658216..57658287 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000698368 Chr9:57684489..57684600 No primer for this exon
upstream ENSMUSE00000444631 Chr9:57681423..57682043 No primer for this exon
upstream ENSMUSE00000478601 Chr9:57681423..57682039 No primer for this exon

*** Putative Vector Insertion (Chr 9: 57658288 - 57681422) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000464653 Chr9:57658216..57658287 No primer for this exon
downstream ENSMUSE00000218667 Chr9:57657972..57658044 No primer for this exon
downstream ENSMUSE00000534120 Chr9:57657968..57658044 No primer for this exon
downstream ENSMUSE00000636512 Chr9:57653238..57653346 No primer for this exon
downstream ENSMUSE00000486564 Chr9:57645849..57646032 No primer for this exon
downstream ENSMUSE00000636511 Chr9:57645849..57646032 No primer for this exon
downstream ENSMUSE00000484441 Chr9:57644279..57644595 No primer for this exon
downstream ENSMUSE00000636510 Chr9:57644279..57644595 No primer for this exon
downstream ENSMUSE00000467845 Chr9:57643914..57644159 No primer for this exon
downstream ENSMUSE00000636508 Chr9:57643914..57644159 No primer for this exon
downstream ENSMUSE00000465630 Chr9:57642743..57642841 No primer for this exon
downstream ENSMUSE00000636507 Chr9:57642494..57642841 No primer for this exon
downstream ENSMUSE00000698353 Chr9:57640323..57640492 No primer for this exon
downstream ENSMUSE00000464736 Chr9:57638320..57640492 No primer for this exon
downstream ENSMUSE00000476350 Chr9:57638269..57638422 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAGCCCTAAGGTGGCCATAA Chr9:57672368..57672388 59.56 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATTAAATCCCCAGCCCTCAC Chr9:57675416..57675436 60.15 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TGCATAGCCCCAACCAAATA Chr9:57673036..57673056 61.21 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TGCATAGCCCCAACCAAATA Chr9:57673036..57673056 61.21 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000004661