Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8102
Trapped Gene
Hmox1 (ENSMUSG00000005413)
Vector Insertion
Chr 8: 77617672 - 77619754
Public Clones RRG042 (baygenomics)
Private Clones OST296440 (lexicon)
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000366988 (Chr8:77617521..77617671 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000366988 (Chr8:77617521..77617671 +)
Downstram Exon
ENSMUSE00000408046 (Chr8:77619755..77619875 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000366988 Chr8:77617521..77617671 No primer for this exon

*** Putative Vector Insertion (Chr 8: 77617672 - 77619754) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000408046 Chr8:77619755..77619875 No primer for this exon
downstream ENSMUSE00000324535 Chr8:77620749..77621240 No primer for this exon
downstream ENSMUSE00000635992 Chr8:77620749..77620874 No primer for this exon
downstream ENSMUSE00000211210 Chr8:77622665..77622764 No primer for this exon
downstream ENSMUSE00000362011 Chr8:77623785..77624488 No primer for this exon
downstream ENSMUSE00000635990 Chr8:77624263..77624343 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGGTGTCCCTTATCCTGCTA Chr8:77617705..77617725 60.09 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000005413