Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8108
Trapped Gene
Tyw3 (ENSMUSG00000047583)
Vector Insertion
Chr 3: 154257499 - 154259816
Public Clones RRG118 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 22% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000349324 (Chr3:154259817..154260059 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AACTCGCGGGAAGAGTTTTT Chr3:154259860..154259879 60.24 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000349324 (Chr3:154259817..154260059 -)
Downstram Exon
ENSMUSE00000407840 (Chr3:154257418..154257498 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AACTCGCGGGAAGAGTTTTT Chr3:154259860..154259879 60.24 45 GGTTTGTGTGTGACCAGCAG Chr3:154257415..154257434 60.2 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000349324 Chr3:154259817..154260059 AACTCGCGGGAAGAGTTTTT Chr3:154259860..154259879 60.24 45

*** Putative Vector Insertion (Chr 3: 154257499 - 154259816) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000407840 Chr3:154257418..154257498 GGTTTGTGTGTGACCAGCAG Chr3:154257415..154257434 60.2 55
downstream ENSMUSE00000341074 Chr3:154256681..154256779 GCATTGCACATGGAGGATAA Chr3:154256686..154256705 59.5 45
downstream ENSMUSE00000389975 Chr3:154254048..154254119 GATGCCAGAGTTCCTGAAGC Chr3:154254056..154254075 59.96 55
downstream ENSMUSE00000343585 Chr3:154250441..154250574 TTTCCCTTGTGGGTTAATGG Chr3:154250503..154250522 59.66 45
downstream ENSMUSE00000380831 Chr3:154240163..154243255 CAGGGTTGGAGTGAGGTTGT Chr3:154242685..154242704 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000047583