Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8117
Trapped Gene
Fiz1 (ENSMUSG00000061374)
Vector Insertion
Chr 7: 4960808 - 4964279
Public Clones RRG188 (baygenomics) RRG347 (baygenomics) D060F12 (ggtc) (ggtc)
IST13201G3 (tigm) IST10913G6 (tigm)
Private Clones OST258294 (lexicon)
Severity of mutation (?) Insertion after 21% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000538380 (Chr7:4964280..4964624 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTAGCGAATGTGGCAAGAG Chr7:4964482..4964501 60.01 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000538380 (Chr7:4964280..4964624 -)
Downstram Exon
ENSMUSE00000494517 (Chr7:4958662..4960807 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTAGCGAATGTGGCAAGAG Chr7:4964482..4964501 60.01 50 ATCTTCTTGCTACGGCTGGA Chr7:4959848..4959867 59.98 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000677251 Chr7:4966227..4966254 No primer for this exon
upstream ENSMUSE00000538380 Chr7:4964280..4964624 TGTAGCGAATGTGGCAAGAG Chr7:4964482..4964501 60.01 50

*** Putative Vector Insertion (Chr 7: 4960808 - 4964279) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000494517 Chr7:4958662..4960807 ATCTTCTTGCTACGGCTGGA Chr7:4959848..4959867 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACTGGGACTCCATTCCACT Chr7:4964228..4964248 59.96 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACTGGGACTCCATTCCACT Chr7:4964228..4964248 59.96 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TCTTTCTAATCGCCTTGCAG Chr7:4961560..4961580 58.27 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TTTCCGTGACTGGGAAAACC Chr7:4964558..4964578 62.17 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000061374