Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8121
Trapped Gene
Morc2a (ENSMUSG00000034543)
Vector Insertion
Chr 11: 3588303 - 3589037
Public Clones RRG198 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 98% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000656252 (Chr11:3588114..3588302 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTACCAAAGCCGTGCTGATT Chr11:3588164..3588183 60.27 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000656252 (Chr11:3588114..3588302 +)
Downstram Exon
ENSMUSE00000339106 (Chr11:3589038..3590373 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTACCAAAGCCGTGCTGATT Chr11:3588164..3588183 60.27 50 AGCCATCAGATGAAGCTCGT Chr11:3590002..3590021 59.98 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000581526 Chr11:3549497..3550149 AAGCGGTGAAGCCAGAAGTA Chr11:3549868..3549887 60.01 50
upstream ENSMUSE00000682340 Chr11:3550256..3550450 TCCTGTTAACCGGCAAAGAC Chr11:3550345..3550364 60.11 50
upstream ENSMUSE00000581525 Chr11:3550311..3550450 TCCTGTTAACCGGCAAAGAC Chr11:3550345..3550364 60.11 50
upstream ENSMUSE00000581524 Chr11:3558675..3558728 GGTGCTCTTGCTGAACTGGT Chr11:3558697..3558716 60.45 55
upstream ENSMUSE00000581523 Chr11:3561832..3561866 No primer for this exon
upstream ENSMUSE00000581522 Chr11:3568774..3568842 GAGGACCTTCGAGGAGGATT Chr11:3568782..3568801 59.64 55
upstream ENSMUSE00000312400 Chr11:3569332..3569422 GTCCACTCAAATTGGGCAGT Chr11:3569384..3569403 59.97 50
upstream ENSMUSE00000656262 Chr11:3572269..3572377 TTCTTGTCTCGCACCTTTCA Chr11:3572336..3572355 59.57 45
upstream ENSMUSE00000656261 Chr11:3575831..3575990 CGAACACGGGAACCTATCAC Chr11:3575861..3575880 60.38 55
upstream ENSMUSE00000656260 Chr11:3576107..3576218 TGGAGAGCCGGAACTAGACA Chr11:3576147..3576166 60.93 55
upstream ENSMUSE00000623971 Chr11:3576645..3576770 CATGGACACAAGGTGCAGAC Chr11:3576718..3576737 60.16 55
upstream ENSMUSE00000656259 Chr11:3577406..3577485 TTTCAAGACTCGGGCAGAAC Chr11:3577430..3577449 60.38 50
upstream ENSMUSE00000656258 Chr11:3578230..3578312 AAGTACGCATGGGTGGAGAC Chr11:3578275..3578294 60 55
upstream ENSMUSE00000656257 Chr11:3578539..3578624 TACAGCCATCACCCTTCGTA Chr11:3578562..3578581 59.15 50
upstream ENSMUSE00000656279 Chr11:3579659..3579799 GAACACCGGGACTTAGATGG Chr11:3579708..3579727 59.4 55
upstream ENSMUSE00000656278 Chr11:3579883..3580037 CGGCATCTACTTCGAGCAAT Chr11:3579977..3579996 60.37 50
upstream ENSMUSE00000656277 Chr11:3580178..3580306 CAACTGGAACCAACCTCCAT Chr11:3580227..3580246 59.82 50
upstream ENSMUSE00000656255 Chr11:3580786..3580891 CTTGGGTTTGCTCCATGAAC Chr11:3580852..3580871 60.49 50
upstream ENSMUSE00000656275 Chr11:3581678..3581810 AAAGGTTCCTTTGGGGACAT Chr11:3581702..3581721 59.67 45
upstream ENSMUSE00000656274 Chr11:3583548..3583619 GCTCACAAGCTGACCTGAAG Chr11:3583564..3583583 58.75 55
upstream ENSMUSE00000656273 Chr11:3583702..3584079 GGCTACTCCAGCCAACTGAG Chr11:3583883..3583902 60.01 60
upstream ENSMUSE00000656272 Chr11:3584617..3584748 TTGCTGTGAAGGAGGAAAAGA Chr11:3584714..3584734 59.98 42.86
upstream ENSMUSE00000656271 Chr11:3584841..3584895 ACCCAGCTGAACTCAGGAAG Chr11:3584866..3584885 59.45 55
upstream ENSMUSE00000656270 Chr11:3585388..3585529 AGTGGTACACAGGCCGAGTC Chr11:3585424..3585443 60.18 60
upstream ENSMUSE00000656269 Chr11:3585661..3585885 TTCCCATTGAGCCTGATACC Chr11:3585813..3585832 59.89 50
upstream ENSMUSE00000656268 Chr11:3585979..3586072 CTCCAAGTTTCCCCATCTCC Chr11:3586002..3586021 60.82 55
upstream ENSMUSE00000656252 Chr11:3588114..3588302 CTACCAAAGCCGTGCTGATT Chr11:3588164..3588183 60.27 50

*** Putative Vector Insertion (Chr 11: 3588303 - 3589037) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000339106 Chr11:3589038..3590373 AGCCATCAGATGAAGCTCGT Chr11:3590002..3590021 59.98 50
downstream ENSMUSE00000656265 Chr11:3589038..3590480 AGCCATCAGATGAAGCTCGT Chr11:3590002..3590021 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTCTCAGGGAGGGGTAATC Chr11:3588339..3588359 59.76 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAAGTGCAGGAGGTGAGCTG Chr11:3588292..3588312 60.59 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034543