Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8126
Trapped Gene
Ppp1r12c (ENSMUSG00000019254)
Vector Insertion
Chr 7: 4435336 - 4435542
Public Clones RRG222 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 68% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000601215 (Chr7:4435543..4435674 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000601215 (Chr7:4435543..4435674 -)
Downstram Exon
ENSMUSE00000601214 (Chr7:4435245..4435335 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000538583 Chr7:4452868..4453282 No primer for this exon
upstream ENSMUSE00000134776 Chr7:4449018..4449148 No primer for this exon
upstream ENSMUSE00000305613 Chr7:4448819..4448937 No primer for this exon
upstream ENSMUSE00000601223 Chr7:4441335..4441494 No primer for this exon
upstream ENSMUSE00000601222 Chr7:4438113..4438257 No primer for this exon
upstream ENSMUSE00000601221 Chr7:4437960..4438034 No primer for this exon
upstream ENSMUSE00000601220 Chr7:4436991..4437064 No primer for this exon
upstream ENSMUSE00000601219 Chr7:4436791..4436918 No primer for this exon
upstream ENSMUSE00000601218 Chr7:4436613..4436686 No primer for this exon
upstream ENSMUSE00000601217 Chr7:4436221..4436373 No primer for this exon
upstream ENSMUSE00000601216 Chr7:4436052..4436119 No primer for this exon
upstream ENSMUSE00000601215 Chr7:4435543..4435674 No primer for this exon

*** Putative Vector Insertion (Chr 7: 4435336 - 4435542) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000601214 Chr7:4435245..4435335 No primer for this exon
downstream ENSMUSE00000601213 Chr7:4435076..4435159 No primer for this exon
downstream ENSMUSE00000601212 Chr7:4434943..4435003 No primer for this exon
downstream ENSMUSE00000601211 Chr7:4434705..4434787 No primer for this exon
downstream ENSMUSE00000601229 Chr7:4434575..4434615 No primer for this exon
downstream ENSMUSE00000601228 Chr7:4434393..4434495 No primer for this exon
downstream ENSMUSE00000601227 Chr7:4434186..4434290 No primer for this exon
downstream ENSMUSE00000601226 Chr7:4433981..4434031 No primer for this exon
downstream ENSMUSE00000601225 Chr7:4433839..4433889 No primer for this exon
downstream ENSMUSE00000601224 Chr7:4433123..4433760 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACCGTCGGAGGTAAAGAGG Chr7:4435532..4435552 61.01 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCTCGTGACTGGGAAAACC Chr7:4435475..4435495 59.56 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019254