Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8133
Trapped Gene
Psme4 (ENSMUSG00000040850)
Vector Insertion
Chr 11: 30756029 - 30756116
Public Clones RRG348 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 86% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000254992 (Chr11:30756030..30756115 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATGGCTTATGGCAAGTGCAG Chr11:30756037..30756056 61.19 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000254992 (Chr11:30756030..30756115 +)
Downstram Exon
ENSMUSE00000654777 (Chr11:30756030..30756115 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATGGCTTATGGCAAGTGCAG Chr11:30756037..30756056 61.19 50 TCTTCCTGCACTTGCCATAA Chr11:30756064..30756083 59.42 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000433171 Chr11:30671775..30672224 TGGCACAGATCAAGAGCAAC Chr11:30672137..30672156 59.99 50
upstream ENSMUSE00000580496 Chr11:30672322..30672587 TCAGCGTTCTGGTCCTTTCT Chr11:30672410..30672429 59.99 50
upstream ENSMUSE00000403814 Chr11:30691092..30691232 GGATTTGCCCGTCTCTTGAT Chr11:30691201..30691220 61.36 50
upstream ENSMUSE00000433142 Chr11:30691922..30692038 TTCCAAGACAGAGCACCTGA Chr11:30692000..30692019 59.54 50
upstream ENSMUSE00000255284 Chr11:30702814..30702858 No primer for this exon
upstream ENSMUSE00000718109 Chr11:30704290..30704439 CCAGCAGATTCAACAGCAGA Chr11:30704297..30704316 60.14 50
upstream ENSMUSE00000720067 Chr11:30704290..30704439 CCAGCAGATTCAACAGCAGA Chr11:30704297..30704316 60.14 50
upstream ENSMUSE00000255277 Chr11:30704963..30705026 TTAATTGGCCTTTGGGTTTC Chr11:30704979..30704998 58.92 40
upstream ENSMUSE00000680294 Chr11:30704963..30705026 TTAATTGGCCTTTGGGTTTC Chr11:30704979..30704998 58.92 40
upstream ENSMUSE00000255269 Chr11:30706255..30706329 TTTGCTCGATTGGCTACAGA Chr11:30706270..30706289 59.57 45
upstream ENSMUSE00000680293 Chr11:30706255..30706329 TTTGCTCGATTGGCTACAGA Chr11:30706270..30706289 59.57 45
upstream ENSMUSE00000433115 Chr11:30707703..30707825 AGAAGCCTGAACCTCCCAGT Chr11:30707721..30707740 60.25 55
upstream ENSMUSE00000680292 Chr11:30707703..30707825 AGAAGCCTGAACCTCCCAGT Chr11:30707721..30707740 60.25 55
upstream ENSMUSE00000433107 Chr11:30709836..30709928 CCTTCAAATAATGGGCGTTG Chr11:30709905..30709924 60.31 45
upstream ENSMUSE00000680291 Chr11:30709836..30709928 CCTTCAAATAATGGGCGTTG Chr11:30709905..30709924 60.31 45
upstream ENSMUSE00000387542 Chr11:30710783..30711048 AAGCCCTCCTGGTTAACTCC Chr11:30710855..30710874 59.58 55
upstream ENSMUSE00000680290 Chr11:30710783..30711048 AAGCCCTCCTGGTTAACTCC Chr11:30710855..30710874 59.58 55
upstream ENSMUSE00000355379 Chr11:30711978..30712164 TTGGAGTAGCCCGAAGTTTG Chr11:30712043..30712062 60.24 50
upstream ENSMUSE00000680289 Chr11:30711978..30712164 TTGGAGTAGCCCGAAGTTTG Chr11:30712043..30712062 60.24 50
upstream ENSMUSE00000433094 Chr11:30713663..30713752 No primer for this exon
upstream ENSMUSE00000680288 Chr11:30713663..30713752 No primer for this exon
upstream ENSMUSE00000255237 Chr11:30715228..30715292 GTTCGGCAACAGCTGAATTT Chr11:30715244..30715263 60.26 45
upstream ENSMUSE00000680287 Chr11:30715228..30715292 GTTCGGCAACAGCTGAATTT Chr11:30715244..30715263 60.26 45
upstream ENSMUSE00000255232 Chr11:30715558..30715708 TGGAGCAAACAAGGGAAGAG Chr11:30715587..30715606 60.37 50
upstream ENSMUSE00000680286 Chr11:30715558..30715708 TGGAGCAAACAAGGGAAGAG Chr11:30715587..30715606 60.37 50
upstream ENSMUSE00000255225 Chr11:30717731..30717829 No primer for this exon
upstream ENSMUSE00000680285 Chr11:30717731..30717829 No primer for this exon
upstream ENSMUSE00000433076 Chr11:30718089..30718158 GTTCCCCACTGCTATGGTGT Chr11:30718119..30718138 59.85 55
upstream ENSMUSE00000680284 Chr11:30718089..30718158 GTTCCCCACTGCTATGGTGT Chr11:30718119..30718138 59.85 55
upstream ENSMUSE00000433071 Chr11:30719004..30719071 TGTGGAACCTTCAGCTTCTG Chr11:30719046..30719065 59.01 50
upstream ENSMUSE00000680283 Chr11:30719004..30719071 TGTGGAACCTTCAGCTTCTG Chr11:30719046..30719065 59.01 50
upstream ENSMUSE00000255218 Chr11:30719928..30720143 ACGCTGTCTTGCAACCTTCT Chr11:30720024..30720043 60.06 50
upstream ENSMUSE00000680282 Chr11:30719928..30720143 ACGCTGTCTTGCAACCTTCT Chr11:30720024..30720043 60.06 50
upstream ENSMUSE00000433057 Chr11:30720916..30721073 ACTGGGGTAAGCCTGGAGAT Chr11:30720917..30720936 59.96 55
upstream ENSMUSE00000680281 Chr11:30720916..30721073 ACTGGGGTAAGCCTGGAGAT Chr11:30720917..30720936 59.96 55
upstream ENSMUSE00000433050 Chr11:30723059..30723154 CACAGCTGCTTGATTGGTTC Chr11:30723090..30723109 59.44 50
upstream ENSMUSE00000680280 Chr11:30723059..30723154 CACAGCTGCTTGATTGGTTC Chr11:30723090..30723109 59.44 50
upstream ENSMUSE00000255125 Chr11:30730350..30730405 No primer for this exon
upstream ENSMUSE00000680279 Chr11:30730350..30730405 No primer for this exon
upstream ENSMUSE00000255115 Chr11:30732134..30732190 No primer for this exon
upstream ENSMUSE00000680278 Chr11:30732134..30732190 No primer for this exon
upstream ENSMUSE00000255105 Chr11:30732389..30732444 No primer for this exon
upstream ENSMUSE00000680277 Chr11:30732389..30732444 No primer for this exon
upstream ENSMUSE00000433024 Chr11:30732532..30732630 GACCTTCTGCACTTCCAAGG Chr11:30732541..30732560 59.84 55
upstream ENSMUSE00000680276 Chr11:30732532..30732630 GACCTTCTGCACTTCCAAGG Chr11:30732541..30732560 59.84 55
upstream ENSMUSE00000433018 Chr11:30734086..30734148 No primer for this exon
upstream ENSMUSE00000680275 Chr11:30734086..30734148 No primer for this exon
upstream ENSMUSE00000255098 Chr11:30734274..30734369 No primer for this exon
upstream ENSMUSE00000680274 Chr11:30734274..30734369 No primer for this exon
upstream ENSMUSE00000255089 Chr11:30735336..30735467 TGGTTTTGGAATTCCTACGG Chr11:30735412..30735431 59.79 45
upstream ENSMUSE00000680273 Chr11:30735336..30735467 TGGTTTTGGAATTCCTACGG Chr11:30735412..30735431 59.79 45
upstream ENSMUSE00000432996 Chr11:30737282..30737491 CCAAGCAATGTCACTGGAAA Chr11:30737392..30737411 59.69 45
upstream ENSMUSE00000680272 Chr11:30737282..30737491 CCAAGCAATGTCACTGGAAA Chr11:30737392..30737411 59.69 45
upstream ENSMUSE00000389569 Chr11:30738885..30739021 GGACAGAAGCGTCAACAAGA Chr11:30738981..30739000 59.01 50
upstream ENSMUSE00000680271 Chr11:30738885..30739021 GGACAGAAGCGTCAACAAGA Chr11:30738981..30739000 59.01 50
upstream ENSMUSE00000680252 Chr11:30738948..30739021 GGACAGAAGCGTCAACAAGA Chr11:30738981..30739000 59.01 50
upstream ENSMUSE00000349104 Chr11:30741569..30741622 AGATGGTGTGGAGCAAAGAA Chr11:30741599..30741618 58.29 45
upstream ENSMUSE00000680270 Chr11:30741569..30741622 AGATGGTGTGGAGCAAAGAA Chr11:30741599..30741618 58.29 45
upstream ENSMUSE00000255062 Chr11:30741991..30742120 CAGAGTGTTGCCTCTTCGTG Chr11:30742048..30742067 59.62 55
upstream ENSMUSE00000680269 Chr11:30741991..30742120 CAGAGTGTTGCCTCTTCGTG Chr11:30742048..30742067 59.62 55
upstream ENSMUSE00000255054 Chr11:30743507..30743588 GCTATCTCAGCTGTTGCTGGT Chr11:30743510..30743530 59.66 52.38
upstream ENSMUSE00000680268 Chr11:30743507..30743588 GCTATCTCAGCTGTTGCTGGT Chr11:30743510..30743530 59.66 52.38
upstream ENSMUSE00000255049 Chr11:30745180..30745333 No primer for this exon
upstream ENSMUSE00000680267 Chr11:30745180..30745333 No primer for this exon
upstream ENSMUSE00000376365 Chr11:30745828..30745897 GCCTAAACTTGGCAGAAGCA Chr11:30745861..30745880 60.52 50
upstream ENSMUSE00000680266 Chr11:30745828..30745897 GCCTAAACTTGGCAGAAGCA Chr11:30745861..30745880 60.52 50
upstream ENSMUSE00000351771 Chr11:30747398..30747523 AAGTTTAGTCCCCGGCGTTT Chr11:30747491..30747510 62.04 50
upstream ENSMUSE00000680265 Chr11:30747398..30747523 AAGTTTAGTCCCCGGCGTTT Chr11:30747491..30747510 62.04 50
upstream ENSMUSE00000389473 Chr11:30748047..30748199 AGCCCCATTTAGAACGTTTG Chr11:30748090..30748109 59.09 45
upstream ENSMUSE00000680264 Chr11:30748047..30748199 AGCCCCATTTAGAACGTTTG Chr11:30748090..30748109 59.09 45
upstream ENSMUSE00000343793 Chr11:30750603..30750707 GGGGGACCTGTATAGCCACT Chr11:30750682..30750701 60.21 60
upstream ENSMUSE00000708169 Chr11:30750603..30750707 GGGGGACCTGTATAGCCACT Chr11:30750682..30750701 60.21 60
upstream ENSMUSE00000722190 Chr11:30750603..30750707 GGGGGACCTGTATAGCCACT Chr11:30750682..30750701 60.21 60
upstream ENSMUSE00000255014 Chr11:30751143..30751234 GCTTCACTGGCTTTTTGAGC Chr11:30751163..30751182 60.14 50
upstream ENSMUSE00000680261 Chr11:30751143..30751234 GCTTCACTGGCTTTTTGAGC Chr11:30751163..30751182 60.14 50
upstream ENSMUSE00000255006 Chr11:30752673..30752804 AACCAAAACTCACCCAGGTTT Chr11:30752756..30752776 59.76 42.86
upstream ENSMUSE00000680260 Chr11:30752673..30752804 AACCAAAACTCACCCAGGTTT Chr11:30752756..30752776 59.76 42.86
upstream ENSMUSE00000254997 Chr11:30753177..30753385 ACTGCTCGCGTCCTAGAAAA Chr11:30753256..30753275 60.15 50
upstream ENSMUSE00000680258 Chr11:30753177..30753385 ACTGCTCGCGTCCTAGAAAA Chr11:30753256..30753275 60.15 50

*** Putative Vector Insertion (Chr 11: 30756029 - 30756116) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000254992 Chr11:30756030..30756115 TCTTCCTGCACTTGCCATAA Chr11:30756064..30756083 59.42 45
downstream ENSMUSE00000654777 Chr11:30756030..30756115 TCTTCCTGCACTTGCCATAA Chr11:30756064..30756083 59.42 45
downstream ENSMUSE00000680250 Chr11:30756889..30756900 No primer for this exon
downstream ENSMUSE00000254986 Chr11:30761348..30761476 GGTACAGCAACCCCTGAGAC Chr11:30761441..30761460 59.58 60
downstream ENSMUSE00000680257 Chr11:30761348..30761476 GGTACAGCAACCCCTGAGAC Chr11:30761441..30761460 59.58 60
downstream ENSMUSE00000403018 Chr11:30765434..30765589 TGGTCTGGAGGTAGGTCAGC Chr11:30765494..30765513 60.26 60
downstream ENSMUSE00000680256 Chr11:30765434..30765589 TGGTCTGGAGGTAGGTCAGC Chr11:30765494..30765513 60.26 60
downstream ENSMUSE00000103288 Chr11:30774118..30774280 AAGGTGGTAGCAGCCATTTC Chr11:30774146..30774165 59.2 50
downstream ENSMUSE00000680255 Chr11:30774118..30774280 AAGGTGGTAGCAGCCATTTC Chr11:30774146..30774165 59.2 50
downstream ENSMUSE00000103278 Chr11:30776746..30776879 ACACCAGCATGACGTTTGAC Chr11:30776773..30776792 59.6 50
downstream ENSMUSE00000680254 Chr11:30776746..30776879 ACACCAGCATGACGTTTGAC Chr11:30776773..30776792 59.6 50
downstream ENSMUSE00000254929 Chr11:30778379..30778517 ATGTGTCCTTCGGAAATTGG Chr11:30778423..30778442 59.79 45
downstream ENSMUSE00000680253 Chr11:30778379..30778517 ATGTGTCCTTCGGAAATTGG Chr11:30778423..30778442 59.79 45
downstream ENSMUSE00000592970 Chr11:30779664..30780334 TCACCACGGATGATACCTGA Chr11:30779733..30779752 59.92 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTATGGCAAGTGCAGGAAGA Chr11:30756043..30756063 59.42 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCAGTCGTGACTGGGAAAAC Chr11:30756075..30756095 60.7 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040850