Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8136
Trapped Gene
Arhgef3 (ENSMUSG00000021895)
Vector Insertion
Chr 14: 28078772 - 28149362
Public Clones RRG363 (baygenomics) IST12874G1 (tigm) IST12871H1 (tigm) IST10925F11 (tigm)
IST12081H11HMF1 (tigm) IST10525F5 (tigm) IST10843C2 (tigm) IST14685A3 (tigm)
IST12326C1 (tigm) IST12036C4 (tigm) IST14685A3 (tigm) IST12801A2 (tigm)
IST12009D1 (tigm) IST10087A9 (tigm) IST10925F11 (tigm) IST10333B6 (tigm)
IST14305C1 (tigm) IST11879G9 (tigm) IST11836H2 (tigm) IST10118E2 (tigm)
IST10836G12 (tigm) IST12989D9 (tigm) IST10705A5 (tigm) IST14935D12 (tigm)
IST14722B3 (tigm) IST14947D3 (tigm) IST14722B3 (tigm) IST14190A2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000563302 (Chr14:28078709..28078771 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTTCCCAGGATGAAGATGCT Chr14:28078725..28078744 59.09 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000563302 (Chr14:28078709..28078771 +)
Downstram Exon
ENSMUSE00000563242 (Chr14:28149363..28149455 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTTCCCAGGATGAAGATGCT Chr14:28078725..28078744 59.09 50 TGCCCTCTTGACAGTGAGGT Chr14:28149410..28149429 60.86 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000650210 Chr14:28051225..28051339 ACTTAGCAGCCAGGGAATTG Chr14:28051263..28051282 59.34 50
upstream ENSMUSE00000563302 Chr14:28078709..28078771 GTTCCCAGGATGAAGATGCT Chr14:28078725..28078744 59.09 50

*** Putative Vector Insertion (Chr 14: 28078772 - 28149362) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000563242 Chr14:28149363..28149455 TGCCCTCTTGACAGTGAGGT Chr14:28149410..28149429 60.86 55
downstream ENSMUSE00000650209 Chr14:28175976..28176083 TGAGGTTTGCTAGCGATGTG Chr14:28176036..28176055 60.01 50
downstream ENSMUSE00000650208 Chr14:28192777..28192947 CGTGAGCACCTGATTGACAC Chr14:28192926..28192945 60.32 55
downstream ENSMUSE00000650207 Chr14:28197340..28197402 No primer for this exon
downstream ENSMUSE00000650206 Chr14:28199031..28199127 GAGTCCAGGGTCCCAAAAAT Chr14:28199110..28199129 60.17 50
downstream ENSMUSE00000650205 Chr14:28199279..28199355 GTTTCCGAACATCTCGAAGC Chr14:28199314..28199333 59.82 50
downstream ENSMUSE00000650204 Chr14:28207119..28207376 TAAACAGCGCTGGAGGAAGT Chr14:28207235..28207254 60.01 50
downstream ENSMUSE00000650203 Chr14:28210749..28210919 TAATAGCGGCATTCCGATTC Chr14:28210819..28210838 60.03 45
downstream ENSMUSE00000650202 Chr14:28213451..28213637 GATGGGCTGTCGGTACAACT Chr14:28213549..28213568 60 55
downstream ENSMUSE00000445957 Chr14:28214816..28217090 CCAGTCCATGCAGAGCAGTA Chr14:28215471..28215490 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGTCCCTGTTCATGGTGGT Chr14:28117796..28117816 60.1 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGTCCCTGTTCATGGTGGT Chr14:28117796..28117816 60.1 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021895