Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8168
Trapped Gene
Mllt6 (ENSMUSG00000038437)
Vector Insertion
Chr 11: 97535934 - 97536087
Public Clones RRH080 (baygenomics) IST11830H5 (tigm) IST11830G5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 57% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000285944 (Chr11:97535752..97535933 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCCCATCTCTCATGGTGGA Chr11:97535773..97535792 60.29 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000285944 (Chr11:97535752..97535933 +)
Downstram Exon
ENSMUSE00000285939 (Chr11:97536088..97536196 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCCCATCTCTCATGGTGGA Chr11:97535773..97535792 60.29 50 TGAGGAGGGGGTTAACAGTG Chr11:97536175..97536194 59.96 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000380979 Chr11:97524726..97524994 GAAAACCCGCTGGTCTACTG Chr11:97524940..97524959 59.73 55
upstream ENSMUSE00000335074 Chr11:97526269..97526348 ACCCTGGTTCTGCAGGAAAT Chr11:97526300..97526319 60.88 50
upstream ENSMUSE00000286009 Chr11:97526800..97526854 ACAAAGATGGGGCATTGAAG Chr11:97526819..97526838 59.93 45
upstream ENSMUSE00000286000 Chr11:97527044..97527153 CCTCATGATCGCTTCAACAA Chr11:97527133..97527152 59.8 45
upstream ENSMUSE00000285992 Chr11:97528104..97528207 AGCCTGCATGACCTGTAACC Chr11:97528154..97528173 60.14 55
upstream ENSMUSE00000285987 Chr11:97528389..97528482 GGAGGTGGACAACGTCAAGT Chr11:97528428..97528447 60.01 55
upstream ENSMUSE00000285975 Chr11:97530738..97530950 AGAAGCACCCTACCCACCAT Chr11:97530913..97530932 60.77 55
upstream ENSMUSE00000285967 Chr11:97531567..97531665 AACGCCTTAAACAGAAGCACA Chr11:97531583..97531603 59.93 42.86
upstream ENSMUSE00000285958 Chr11:97533771..97533906 TCCTCAGCGACTTCTTCCTC Chr11:97533774..97533793 59.68 55
upstream ENSMUSE00000673758 Chr11:97533771..97533996 AGGGACTCAAAGGGGAGAAA Chr11:97533834..97533853 60.04 50
upstream ENSMUSE00000285949 Chr11:97534774..97535385 CAGCCGGAGGAAGACAAATA Chr11:97534824..97534843 60.21 50
upstream ENSMUSE00000285944 Chr11:97535752..97535933 ATCCCATCTCTCATGGTGGA Chr11:97535773..97535792 60.29 50

*** Putative Vector Insertion (Chr 11: 97535934 - 97536087) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000285939 Chr11:97536088..97536196 TGAGGAGGGGGTTAACAGTG Chr11:97536175..97536194 59.96 55
downstream ENSMUSE00000285928 Chr11:97537453..97537519 No primer for this exon
downstream ENSMUSE00000285919 Chr11:97537684..97537826 AGCTGCTCCATGTTGGTTGT Chr11:97537791..97537810 60.72 50
downstream ENSMUSE00000285912 Chr11:97538176..97538373 TTCGCTGTCAGGCTAAGGAT Chr11:97538260..97538279 59.98 50
downstream ENSMUSE00000285904 Chr11:97538462..97538550 GAGGTGGACAGGGAATTGTC Chr11:97538546..97538565 59.36 55
downstream ENSMUSE00000285893 Chr11:97539628..97539977 CTGTGGAAGGAGAGCGAAGA Chr11:97539683..97539702 60.67 55
downstream ENSMUSE00000285881 Chr11:97540279..97540369 GCTGAAGGAGGTGTCTCTGC Chr11:97540313..97540332 60.14 60
downstream ENSMUSE00000285873 Chr11:97541784..97542140 CTTGTATTGCTGCCCAGTGA Chr11:97542013..97542032 59.86 50
downstream ENSMUSE00000375518 Chr11:97542860..97546757 CAGGAGCTTGAGAGGGACAC Chr11:97546012..97546031 59.99 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGAAGCTAATCGCCTTGCAG Chr11:97535979..97535999 59.75 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCATCTCCACCACTCAGGT Chr11:97535917..97535937 60.53 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038437